ID: 1146310457

View in Genome Browser
Species Human (GRCh38)
Location 17:31764552-31764574
Sequence GAGGCTTATCACTAATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146310457_1146310464 26 Left 1146310457 17:31764552-31764574 CCTTCCTATTAGTGATAAGCCTC No data
Right 1146310464 17:31764601-31764623 ATAAGCAAAGAAACCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146310457 Original CRISPR GAGGCTTATCACTAATAGGA AGG (reversed) Intergenic
No off target data available for this crispr