ID: 1146315765

View in Genome Browser
Species Human (GRCh38)
Location 17:31805703-31805725
Sequence CTGGGGCATGGAAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146315753_1146315765 5 Left 1146315753 17:31805675-31805697 CCTAAGCTGAGATAAGCTCTTGG No data
Right 1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG No data
1146315751_1146315765 10 Left 1146315751 17:31805670-31805692 CCCAACCTAAGCTGAGATAAGCT No data
Right 1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG No data
1146315750_1146315765 11 Left 1146315750 17:31805669-31805691 CCCCAACCTAAGCTGAGATAAGC No data
Right 1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG No data
1146315749_1146315765 24 Left 1146315749 17:31805656-31805678 CCAAGTGAAGCAGCCCCAACCTA No data
Right 1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG No data
1146315752_1146315765 9 Left 1146315752 17:31805671-31805693 CCAACCTAAGCTGAGATAAGCTC No data
Right 1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146315765 Original CRISPR CTGGGGCATGGAAGGGAGGA GGG Intergenic
No off target data available for this crispr