ID: 1146322375

View in Genome Browser
Species Human (GRCh38)
Location 17:31857075-31857097
Sequence TGCCACGGTGAAGTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146322375_1146322378 0 Left 1146322375 17:31857075-31857097 CCTCATGACACTTCACCGTGGCA 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1146322378 17:31857098-31857120 GCAGGAATGCCTTCCTATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146322375 Original CRISPR TGCCACGGTGAAGTGTCATG AGG (reversed) Intronic