ID: 1146322375

View in Genome Browser
Species Human (GRCh38)
Location 17:31857075-31857097
Sequence TGCCACGGTGAAGTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146322375_1146322378 0 Left 1146322375 17:31857075-31857097 CCTCATGACACTTCACCGTGGCA 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1146322378 17:31857098-31857120 GCAGGAATGCCTTCCTATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146322375 Original CRISPR TGCCACGGTGAAGTGTCATG AGG (reversed) Intronic
900329460 1:2126807-2126829 TGCCACAATGCAGTGGCATGGGG - Intronic
904285536 1:29451240-29451262 TGCCAAGGTGAATTGCCCTGAGG + Intergenic
908643082 1:66246755-66246777 TCCCACAGAGGAGTGTCATGAGG - Intronic
919247767 1:195011089-195011111 TGCCCTGGTCAAATGTCATGGGG - Intergenic
923051092 1:230392125-230392147 TGCCTTGGTCATGTGTCATGGGG + Intronic
1064284965 10:13984108-13984130 GACCACGGTGAAGTGGCCTGGGG + Intronic
1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG + Intronic
1076168494 10:128301267-128301289 GGCCAGGGTGATGTGTCATGAGG + Intergenic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1080106658 11:28518240-28518262 TGCCACCCAGATGTGTCATGTGG - Intergenic
1081755841 11:45543874-45543896 TGCCACAGGGAACTGTTATGTGG + Intergenic
1083415185 11:62520985-62521007 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415288 11:62521591-62521613 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG + Intergenic
1085122853 11:73978321-73978343 TGCCACTGTGAAGTTTCTTGGGG - Exonic
1097678499 12:62627523-62627545 TGCCATGGTTAAGTTTCCTGAGG + Intergenic
1102721010 12:115016062-115016084 TCCAACAGAGAAGTGTCATGTGG - Intergenic
1108176807 13:47800789-47800811 TGCCAAGGTGTACTGTCAGGTGG - Intergenic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1118454490 14:65932152-65932174 TGCCCAGGGGAAGTGTCTTGGGG - Intergenic
1118730038 14:68659593-68659615 TGCCCCGGTGCAGTGTCCTGAGG - Intronic
1135970456 16:27068411-27068433 GGCCAGGATGAAGTTTCATGTGG - Intergenic
1141607541 16:85163331-85163353 TGCAACCGAGAAGTGCCATGAGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143839158 17:9717836-9717858 TGCCAGGCTGAAGTGCAATGGGG + Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1148197993 17:45728632-45728654 TGCCCCGGTGAAGTTCCATGTGG - Intergenic
1161313894 19:3609007-3609029 GGCCATGGTGGAGAGTCATGGGG + Intergenic
1162719070 19:12651129-12651151 TGCCACGCTCAAGAGTGATGTGG - Intronic
925589119 2:5492881-5492903 TGCCACAGGGACGTGTGATGGGG - Intergenic
928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG + Intronic
930289293 2:49473018-49473040 TGCCTGGGTAAAGAGTCATGAGG + Intergenic
934689255 2:96345687-96345709 GGACATGGTGAAGTGTCATGAGG + Intronic
937246307 2:120496299-120496321 TGCCTCTGTGAAGTGGGATGAGG + Intergenic
947994507 2:234515693-234515715 TGCCAGGCAGAGGTGTCATGTGG + Intergenic
1168957781 20:1846586-1846608 GGCCACAGTGAGGTGCCATGGGG + Intergenic
1169630575 20:7626142-7626164 TGCACCGGTGAAGGGTCAGGTGG - Intergenic
1169675289 20:8146171-8146193 TGCAATATTGAAGTGTCATGGGG + Intronic
1169806989 20:9569590-9569612 TGCCACTGAGAAGTGGGATGGGG + Intronic
1173104737 20:40123242-40123264 TGCCACCATGAAGTTTGATGGGG - Intergenic
1174531780 20:51220116-51220138 TGCCACTGTGGAGTGTCCTATGG + Intergenic
1175957455 20:62618647-62618669 TTTCACAGTGAACTGTCATGGGG - Intergenic
1176636534 21:9248909-9248931 TGGCACGGTGAAATGAAATGTGG + Intergenic
1182301452 22:29339516-29339538 TGACAAGGCGACGTGTCATGGGG + Intronic
1182365595 22:29776851-29776873 TGCCATTGTGCAGTATCATGGGG - Intergenic
953555996 3:43947517-43947539 TTCCACAGTGAAGAGTAATGTGG - Intergenic
954749544 3:52805894-52805916 AGCCACGGTGGAGGGACATGTGG - Intronic
955067895 3:55548142-55548164 TGCCAGGCTGAAGTGACCTGTGG + Intronic
961374469 3:126454617-126454639 TGTCACAGTGAAGTGTAATGAGG - Intronic
968127887 3:196173689-196173711 TGACTCGGTGAAATGTCTTGTGG - Intergenic
971100223 4:23458353-23458375 TTCCACAGGGGAGTGTCATGAGG - Intergenic
1202751423 4_GL000008v2_random:7338-7360 TGGCACGGTGAAATGAAATGTGG + Intergenic
988637074 5:32996090-32996112 TGCCAAGATGAGGTATCATGTGG + Intergenic
991133405 5:63153050-63153072 TTCCACGGGGTGGTGTCATGAGG - Intergenic
992371786 5:76151414-76151436 TGACATGGTGAAATGTCATTTGG + Intronic
999198967 5:149802640-149802662 TGCCTCACAGAAGTGTCATGAGG - Intronic
1001280143 5:170380888-170380910 TGCCTAGGAGAACTGTCATGGGG + Intronic
1006844910 6:37055503-37055525 TGGCAAGGTGAGGTGTCAGGTGG - Intergenic
1018973763 6:168547840-168547862 TGCCATGGTGCATTCTCATGAGG + Intronic
1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG + Intronic
1025152751 7:56573088-56573110 TGCCATGCTGGAGTGTCAGGCGG + Intergenic
1026483839 7:70800971-70800993 TGACATGGGGCAGTGTCATGGGG - Intergenic
1030579002 7:111328786-111328808 GGGCACGTTGAAGTTTCATGTGG - Intronic
1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG + Intronic
1037324065 8:17670996-17671018 TTCCACTGTGAAATGGCATGAGG + Intronic
1038179394 8:25212440-25212462 GGCCACGGGCAAGTTTCATGTGG + Intronic
1039105065 8:33981289-33981311 CGTCACTGTGAAGTGTGATGGGG + Intergenic
1041465612 8:58155097-58155119 GGCCACTGTGATCTGTCATGAGG + Intronic
1052317358 9:27129468-27129490 TGCAAGGGGGAAGTGGCATGGGG - Intronic
1061912912 9:133734309-133734331 TGCCATGGGGAAGTGGCAAGAGG - Intronic
1062471003 9:136704432-136704454 TGCCACGATGATGTTTCCTGAGG - Intergenic
1203718999 Un_KI270742v1:186203-186225 TGGCACGGTGAAATGAAATGTGG - Intergenic
1190650316 X:52563044-52563066 TCTCAGGGTGAAGGGTCATGAGG - Intergenic