ID: 1146322378

View in Genome Browser
Species Human (GRCh38)
Location 17:31857098-31857120
Sequence GCAGGAATGCCTTCCTATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146322373_1146322378 19 Left 1146322373 17:31857056-31857078 CCTATTCATGTAGGCATCACCTC 0: 1
1: 0
2: 1
3: 29
4: 190
Right 1146322378 17:31857098-31857120 GCAGGAATGCCTTCCTATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
1146322372_1146322378 23 Left 1146322372 17:31857052-31857074 CCTTCCTATTCATGTAGGCATCA 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1146322378 17:31857098-31857120 GCAGGAATGCCTTCCTATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
1146322370_1146322378 30 Left 1146322370 17:31857045-31857067 CCTTGTTCCTTCCTATTCATGTA 0: 1
1: 0
2: 4
3: 29
4: 317
Right 1146322378 17:31857098-31857120 GCAGGAATGCCTTCCTATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
1146322375_1146322378 0 Left 1146322375 17:31857075-31857097 CCTCATGACACTTCACCGTGGCA 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1146322378 17:31857098-31857120 GCAGGAATGCCTTCCTATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146322378 Original CRISPR GCAGGAATGCCTTCCTATAG TGG Intronic
906274685 1:44507155-44507177 AGAGGAATGCCTTCTTCTAGCGG + Intronic
906472847 1:46145603-46145625 ATATTAATGCCTTCCTATAGGGG - Intronic
906791075 1:48659242-48659264 GCAGCAATGTCTTCCTCAAGGGG - Intronic
907868311 1:58420034-58420056 CCAGGAATGTCTTTCTATACAGG - Intronic
911483363 1:98473693-98473715 GAAAGCATGCCTTACTATAGTGG - Intergenic
913574765 1:120161124-120161146 TCAGGAAAGGCTTACTATAGTGG - Intronic
914296031 1:146325961-146325983 TCAGGAAAGGCTTACTATAGTGG - Intergenic
914557072 1:148776747-148776769 TCAGGAAAGGCTTACTATAGTGG - Intergenic
914615762 1:149353483-149353505 TCAGGAAAGGCTTACTATAGTGG + Intergenic
917491705 1:175503838-175503860 TCAGCAATGCCTTCCTTTTGAGG + Intronic
919730272 1:200909173-200909195 GCAGGAATGCCTCCATTCAGGGG - Intronic
922449896 1:225728534-225728556 GCAGGAAAGCCCTCCAACAGTGG - Intergenic
923321860 1:232842274-232842296 GAAGGAATGGCTTGCTATGGTGG - Intergenic
924305404 1:242683328-242683350 GCAAGAATGCTTTTCTATAAGGG + Intergenic
924503880 1:244662747-244662769 TCAGGAATGCCTTCTTAGTGAGG - Intronic
1063237277 10:4130209-4130231 GCAGGAATCCCATCCTAGAGTGG + Intergenic
1063505847 10:6598977-6598999 GCAGGCATGTCTTCATATGGTGG - Intergenic
1069600983 10:69707934-69707956 GTGGGAATGCCTTCCTCTAGAGG + Intergenic
1073001261 10:100287665-100287687 GCAGGAATGGCTTGAAATAGTGG - Intergenic
1078590706 11:12638279-12638301 GTAGGAATGGATTTCTATAGAGG - Intergenic
1081487611 11:43543962-43543984 TCAGGCATGGCTTCATATAGGGG - Intergenic
1083104571 11:60345717-60345739 GCAGGATTGCTGTCCTCTAGGGG - Intronic
1084658339 11:70532374-70532396 GCTGGCATGCCTGCCTAGAGTGG + Intronic
1085311584 11:75520142-75520164 GCAGGGAGGCCTTCCCTTAGGGG - Intronic
1086994606 11:93341865-93341887 GCAGGATTGCCCCCCTCTAGAGG + Intronic
1088406106 11:109480633-109480655 GCAGGAAGGACTTCATATTGTGG + Intergenic
1088665330 11:112088045-112088067 GCAGGACTTCCTACCTGTAGGGG + Intronic
1090273739 11:125405341-125405363 CCAGGAATTCCTTCCTTGAGTGG + Intronic
1091737124 12:2932092-2932114 GCATGAATACCATCCTATATAGG - Intronic
1092287617 12:7137994-7138016 GTAGGATTGCCTTCCTCTACTGG + Exonic
1094154470 12:27324002-27324024 GTAGGAATGTCTTCCTAATGGGG + Exonic
1097145166 12:56934971-56934993 GCAGCAGGGCCCTCCTATAGGGG + Intergenic
1097444991 12:59659782-59659804 CCAGATATGCCTTCCTACAGAGG - Intronic
1097934763 12:65234114-65234136 GCTGGAATGCCTTACCTTAGAGG + Intronic
1099085840 12:78244800-78244822 CCAGGTATGTCTTCCTATACAGG - Intergenic
1104432404 12:128727122-128727144 GCAGGACTGCTTTCTTCTAGAGG - Intergenic
1105097830 13:16401215-16401237 ACAGGAATATCTTCCTATAAAGG + Intergenic
1105139836 13:17087486-17087508 ACAGGAATATCTTCCTATAAAGG + Intergenic
1107540501 13:41384854-41384876 GCAGGAAGGCCTTCCTCCACTGG - Intergenic
1111542773 13:89689900-89689922 GCAGGAAGGACTTCGTATTGTGG + Intergenic
1111588851 13:90317279-90317301 ACAGGACTGGCTTCCTATACTGG + Intergenic
1113589385 13:111487825-111487847 CCGGCAATGCCTTCCCATAGCGG + Intergenic
1114315094 14:21502471-21502493 GAAGGAATGCCTTCCTGGGGAGG - Intronic
1114614516 14:24061175-24061197 GCAGCAATGCCTTGGTACAGTGG - Intronic
1116694248 14:48151270-48151292 GCAGGTAAATCTTCCTATAGTGG - Intergenic
1117045838 14:51812459-51812481 GCAGGAATGCTTTCTTAAAGAGG + Intergenic
1118420041 14:65592353-65592375 GCATAAGTGGCTTCCTATAGAGG + Intronic
1121962107 14:98270420-98270442 TCAGGAATGCCTTGCCTTAGTGG - Intergenic
1124749556 15:32363164-32363186 ACAGGCCTGCCTACCTATAGTGG + Intergenic
1139794363 16:69470195-69470217 GCAGAAGTGCCTTCCTTCAGAGG - Intergenic
1142303238 16:89270953-89270975 GCTGGCATGCCTTCCCGTAGCGG - Intronic
1143751017 17:9027905-9027927 GGAGGAAGGCCTTCTTAAAGAGG - Intronic
1144937997 17:18915722-18915744 GGATTAATGCCTTCCTATGGGGG - Intronic
1146322378 17:31857098-31857120 GCAGGAATGCCTTCCTATAGTGG + Intronic
1149276473 17:55044431-55044453 GCAACAATGGCTTCCTCTAGAGG - Intronic
1149302882 17:55320871-55320893 GCAAAAATGCCATCCTACAGGGG - Exonic
1150413111 17:64963504-64963526 ACAGGAATGCCTCCCTAGGGAGG - Intergenic
1150798711 17:68261712-68261734 ACAGGAATGCCTCCCTAGGGAGG + Intronic
1151512631 17:74570648-74570670 GCAGGGATGCCTTCCAGGAGAGG - Intergenic
1153074236 18:1144357-1144379 GAAGGAATGCATTCCTGGAGGGG - Intergenic
1155531510 18:26771669-26771691 GCAGAAATGCCTTCCTGTGCAGG + Intergenic
1155828990 18:30487923-30487945 CCAGAAATGCCTCCCAATAGAGG + Intergenic
1157746485 18:50140525-50140547 GGAGGATTTTCTTCCTATAGCGG - Intronic
1157956936 18:52109458-52109480 TCAGGAATGGTTTCCTATAAAGG - Intergenic
1159642629 18:70881488-70881510 GCAGAAACCCCTTCCTTTAGTGG - Intergenic
1160799223 19:960112-960134 CCAGGAATTCCTTCCTCTTGGGG - Exonic
1161585461 19:5103091-5103113 GCAGCAGTGCCTTCCAAAAGGGG - Intronic
1168601243 19:57720367-57720389 GCAGGAAAGCCTTCCCCTGGAGG - Exonic
925364007 2:3298806-3298828 ACTGGAATGCCTTCTTATGGGGG - Intronic
931203377 2:60123028-60123050 GCAGACATGCCTTCCAACAGTGG - Intergenic
936516977 2:113187146-113187168 GCATGAATACCTTCCTCTCGGGG - Intronic
936517577 2:113192179-113192201 GCATGAATACCTTCCTCTCGGGG + Intronic
938315649 2:130326119-130326141 GGTGGAATGCCTTCCTGTAGGGG - Intergenic
944216316 2:197259726-197259748 GCAGGAAGGACTTGCTGTAGAGG + Intronic
945891743 2:215436915-215436937 GCAGGAAAGCCTTCCTTTCCTGG + Intergenic
947213026 2:227725156-227725178 ACAGAAAAGCCTTCCTTTAGAGG - Intergenic
1169538552 20:6575014-6575036 GCATGGATTCCTTCCTATAAGGG - Intergenic
1172771996 20:37387285-37387307 GCAGGACTGCCTTCTCAGAGGGG + Intronic
1179287572 21:39991253-39991275 GAGGGCATGACTTCCTATAGTGG - Intergenic
1180137486 21:45871065-45871087 GCTGCACTGCCTTCCTGTAGGGG - Intronic
950054165 3:10011737-10011759 GCAGGAATGCCTTCCCTTGCAGG - Intergenic
951356933 3:21678696-21678718 GCAGGAATGCCTGCTGAGAGGGG + Intronic
952394618 3:32910199-32910221 CCAGGCATACCTTCCTCTAGAGG + Intergenic
953007749 3:38993910-38993932 GCAGCCTTGCCTTCCTCTAGTGG + Intergenic
963121694 3:141782081-141782103 GCTGGAATGCCTTCTTGTAGGGG + Intronic
965691404 3:171360785-171360807 CCAGGAAAGCCTTCATATAAAGG - Intronic
968282121 3:197485004-197485026 GCATGAATGCCTTGCTAGGGTGG + Intergenic
972009508 4:34158954-34158976 GCAAGAATGACTTCATATTGTGG + Intergenic
982251473 4:153411629-153411651 TCAGGAAATCCTTCCTGTAGAGG + Intronic
990524998 5:56616542-56616564 GCAGGAAAGCTTTCATAGAGAGG + Intergenic
990664905 5:58061416-58061438 GAAGGAGTGGCTTCCTGTAGAGG + Intergenic
994830642 5:104778102-104778124 TCAGGTATTCCTTCCTTTAGGGG - Intergenic
996505307 5:124261753-124261775 ACGGGAAAGCCTTCCTTTAGTGG + Intergenic
997210672 5:132074961-132074983 GCAGGAATGTCTTAATCTAGGGG + Intronic
997513247 5:134467031-134467053 GCAGGAATGCCCTCAAAAAGGGG + Intergenic
999009114 5:148015636-148015658 GGGGGAGTGCCTTCCTATGGAGG + Intergenic
1003376732 6:5585641-5585663 GCAGGATTTCCTTCCTTTTGTGG + Intronic
1004049699 6:12064214-12064236 GAAGCAATGCATCCCTATAGTGG + Intronic
1005175649 6:23041566-23041588 ATAGGAATGCCTTTCTATTGCGG - Intergenic
1005719255 6:28584875-28584897 GCAGAAGTGCCTTCATTTAGTGG - Intronic
1007052320 6:38844762-38844784 GAAGGGAAGCCTTCCTTTAGAGG - Intronic
1007074226 6:39056590-39056612 GCAGGGGTGGCATCCTATAGAGG - Intronic
1007718107 6:43869133-43869155 GCAGGAAAGACTTCACATAGAGG - Intergenic
1011186158 6:84677848-84677870 GCACTCATGCCTTCCTATAATGG + Intergenic
1012534290 6:100277412-100277434 GCTGGAATGTGTTCCTACAGAGG + Intergenic
1014445589 6:121523707-121523729 TCAGCAAGGCCTTCCTCTAGGGG - Intergenic
1016662813 6:146600465-146600487 GCAGAAAAGCTTTCCAATAGGGG - Intronic
1016688064 6:146903656-146903678 GCAGGGGTGCCTTCCTCTTGAGG + Intergenic
1017454750 6:154591501-154591523 GAAGGAATGCCTTTGTTTAGTGG + Intergenic
1027963426 7:84976073-84976095 GCAAGTATGCCTTTCTGTAGGGG + Intergenic
1028222828 7:88217329-88217351 AAAGGAATGCCTTCCAAAAGTGG + Intronic
1045399927 8:101803701-101803723 TCATGGATGACTTCCTATAGGGG + Intronic
1049261897 8:141643699-141643721 GCTGGAATGCTTTCCTATGAAGG + Intergenic
1050100665 9:2115995-2116017 GCAGGAATGCCCTCCGCTCGTGG - Exonic
1050417291 9:5431070-5431092 GCAGGACTGCATCCCTGTAGAGG + Intronic
1051485719 9:17605858-17605880 GTAGGGATGCCTTCCTGTATGGG + Intronic
1058077564 9:100666922-100666944 GCAGGAATGCCTACTTAGACAGG - Intergenic
1062054621 9:134464382-134464404 GCAGGACTCCCTTCCTATCCAGG - Intergenic
1188624125 X:32263722-32263744 CCTGGATGGCCTTCCTATAGAGG - Intronic
1192594269 X:72389729-72389751 GGAAGAATGACTTCCTATACTGG + Intronic
1194327648 X:92540267-92540289 GCAGGAAGGACTTCGTATTGTGG - Intronic
1194586162 X:95736640-95736662 GCAGGAAGGACTTCGTATAGTGG + Intergenic
1199808242 X:151323676-151323698 ACTGTAATGCCTTCTTATAGTGG - Intergenic
1200636359 Y:5659485-5659507 GCAGGAAGGACTTCGTATTGTGG - Intronic