ID: 1146339609

View in Genome Browser
Species Human (GRCh38)
Location 17:32007676-32007698
Sequence GACGTGGGCGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146339609_1146339624 12 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339624 17:32007711-32007733 GGGCTCCCCTCGCCGATACGCGG No data
1146339609_1146339628 22 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339628 17:32007721-32007743 CGCCGATACGCGGTAGTAGCCGG No data
1146339609_1146339632 28 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339632 17:32007727-32007749 TACGCGGTAGTAGCCGGGGCAGG No data
1146339609_1146339631 24 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339631 17:32007723-32007745 CCGATACGCGGTAGTAGCCGGGG No data
1146339609_1146339616 -10 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339616 17:32007689-32007711 CGCCCACGTCCGGACCCATCGGG No data
1146339609_1146339629 23 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339629 17:32007722-32007744 GCCGATACGCGGTAGTAGCCGGG No data
1146339609_1146339617 -9 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339617 17:32007690-32007712 GCCCACGTCCGGACCCATCGGGG No data
1146339609_1146339619 -8 Left 1146339609 17:32007676-32007698 CCGCCGCCGCCGCCGCCCACGTC No data
Right 1146339619 17:32007691-32007713 CCCACGTCCGGACCCATCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146339609 Original CRISPR GACGTGGGCGGCGGCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr