ID: 1146348927

View in Genome Browser
Species Human (GRCh38)
Location 17:32079696-32079718
Sequence CTGTGGATAAGGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146348927_1146348938 12 Left 1146348927 17:32079696-32079718 CCTCCCTCCATCCTTATCCACAG No data
Right 1146348938 17:32079731-32079753 CCAGACCCTCCTCTCCAAACCGG No data
1146348927_1146348941 15 Left 1146348927 17:32079696-32079718 CCTCCCTCCATCCTTATCCACAG No data
Right 1146348941 17:32079734-32079756 GACCCTCCTCTCCAAACCGGGGG No data
1146348927_1146348940 14 Left 1146348927 17:32079696-32079718 CCTCCCTCCATCCTTATCCACAG No data
Right 1146348940 17:32079733-32079755 AGACCCTCCTCTCCAAACCGGGG No data
1146348927_1146348939 13 Left 1146348927 17:32079696-32079718 CCTCCCTCCATCCTTATCCACAG No data
Right 1146348939 17:32079732-32079754 CAGACCCTCCTCTCCAAACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146348927 Original CRISPR CTGTGGATAAGGATGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr