ID: 1146349021

View in Genome Browser
Species Human (GRCh38)
Location 17:32080088-32080110
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146349021_1146349029 10 Left 1146349021 17:32080088-32080110 CCTTGGGAAATGGGGGAGGGCAC No data
Right 1146349029 17:32080121-32080143 GGGACCTCCCTCCTGAATCTGGG No data
1146349021_1146349028 9 Left 1146349021 17:32080088-32080110 CCTTGGGAAATGGGGGAGGGCAC No data
Right 1146349028 17:32080120-32080142 TGGGACCTCCCTCCTGAATCTGG No data
1146349021_1146349031 14 Left 1146349021 17:32080088-32080110 CCTTGGGAAATGGGGGAGGGCAC No data
Right 1146349031 17:32080125-32080147 CCTCCCTCCTGAATCTGGGCAGG No data
1146349021_1146349024 -10 Left 1146349021 17:32080088-32080110 CCTTGGGAAATGGGGGAGGGCAC No data
Right 1146349024 17:32080101-32080123 GGGAGGGCACTGGTACCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146349021 Original CRISPR GTGCCCTCCCCCATTTCCCA AGG (reversed) Intergenic
No off target data available for this crispr