ID: 1146353836

View in Genome Browser
Species Human (GRCh38)
Location 17:32117959-32117981
Sequence CATCAGAGGGAGGGTGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146353824_1146353836 20 Left 1146353824 17:32117916-32117938 CCCTTGAGCAAATGGCTGGACAA No data
Right 1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG No data
1146353825_1146353836 19 Left 1146353825 17:32117917-32117939 CCTTGAGCAAATGGCTGGACAAT No data
Right 1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG No data
1146353829_1146353836 -7 Left 1146353829 17:32117943-32117965 CCTCAGGAGTAGAGCTCATCAGA No data
Right 1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG No data
1146353827_1146353836 -5 Left 1146353827 17:32117941-32117963 CCCCTCAGGAGTAGAGCTCATCA No data
Right 1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG No data
1146353828_1146353836 -6 Left 1146353828 17:32117942-32117964 CCCTCAGGAGTAGAGCTCATCAG No data
Right 1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146353836 Original CRISPR CATCAGAGGGAGGGTGCGGG AGG Intergenic
No off target data available for this crispr