ID: 1146356708

View in Genome Browser
Species Human (GRCh38)
Location 17:32140640-32140662
Sequence TTTCCACTCATTGAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146356703_1146356708 -7 Left 1146356703 17:32140624-32140646 CCTCCTGAATTTCACATTTCCAC No data
Right 1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG No data
1146356702_1146356708 -2 Left 1146356702 17:32140619-32140641 CCAAGCCTCCTGAATTTCACATT No data
Right 1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG No data
1146356704_1146356708 -10 Left 1146356704 17:32140627-32140649 CCTGAATTTCACATTTCCACTCA No data
Right 1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG No data
1146356700_1146356708 16 Left 1146356700 17:32140601-32140623 CCCTGAAAGATCAGGTAACCAAG No data
Right 1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG No data
1146356701_1146356708 15 Left 1146356701 17:32140602-32140624 CCTGAAAGATCAGGTAACCAAGC No data
Right 1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146356708 Original CRISPR TTTCCACTCATTGAGGTGTG GGG Intergenic
No off target data available for this crispr