ID: 1146359022

View in Genome Browser
Species Human (GRCh38)
Location 17:32159320-32159342
Sequence TGCCAACGGGTAACTCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146359022_1146359033 6 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359033 17:32159349-32159371 CAGTGTGATCAGGCATGGAGGGG 0: 1
1: 2
2: 4
3: 23
4: 223
1146359022_1146359036 28 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359036 17:32159371-32159393 GTGGACAGAGAGGAGCCCCGAGG 0: 1
1: 0
2: 5
3: 34
4: 334
1146359022_1146359031 4 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359031 17:32159347-32159369 AGCAGTGTGATCAGGCATGGAGG 0: 1
1: 3
2: 6
3: 32
4: 390
1146359022_1146359034 9 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359034 17:32159352-32159374 TGTGATCAGGCATGGAGGGGTGG 0: 1
1: 0
2: 2
3: 30
4: 308
1146359022_1146359030 1 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359030 17:32159344-32159366 GGGAGCAGTGTGATCAGGCATGG 0: 1
1: 1
2: 3
3: 26
4: 273
1146359022_1146359032 5 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359032 17:32159348-32159370 GCAGTGTGATCAGGCATGGAGGG 0: 1
1: 2
2: 1
3: 17
4: 192
1146359022_1146359029 -4 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359029 17:32159339-32159361 GGCAGGGGAGCAGTGTGATCAGG 0: 1
1: 2
2: 7
3: 40
4: 394
1146359022_1146359035 18 Left 1146359022 17:32159320-32159342 CCGGGCCGAGTTACCCGTTGGCA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1146359035 17:32159361-32159383 GCATGGAGGGGTGGACAGAGAGG 0: 1
1: 1
2: 17
3: 113
4: 1623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146359022 Original CRISPR TGCCAACGGGTAACTCGGCC CGG (reversed) Intronic
904702078 1:32363686-32363708 TGCCGACGGGAAAATCTGCCTGG + Exonic
909801653 1:79817482-79817504 TGCTAACTGGTAGCTCAGCCGGG + Intergenic
1065976395 10:30846455-30846477 TGCCAGCAGGTGACTCAGCCTGG - Intronic
1070328706 10:75403560-75403582 TGCCACCGGGTACCTGGACCTGG + Intergenic
1085654856 11:78304668-78304690 TGGCAAGGGGTAACTGGCCCAGG - Intronic
1119262449 14:73245744-73245766 TCCCAATGGGGAAATCGGCCAGG - Intronic
1135683502 16:24478953-24478975 TGCCACTGGGTGACTGGGCCAGG + Intergenic
1146359022 17:32159320-32159342 TGCCAACGGGTAACTCGGCCCGG - Intronic
1158800661 18:60904681-60904703 TGAAAACGGGTAACTTGCCCAGG + Intergenic
1163644198 19:18479078-18479100 TGTAAACTGGTCACTCGGCCTGG - Intronic
1165512281 19:36272673-36272695 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165512828 19:36275214-36275236 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165513384 19:36277769-36277791 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165513933 19:36280303-36280325 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165514486 19:36282840-36282862 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165515037 19:36285373-36285395 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165515588 19:36287909-36287931 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165516139 19:36290446-36290468 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165516689 19:36292972-36292994 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165517242 19:36295495-36295517 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165517794 19:36298030-36298052 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165518347 19:36300565-36300587 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165518897 19:36303097-36303119 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165519446 19:36305612-36305634 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165519994 19:36308140-36308162 GTCAAACGGGTGACTCGGCCAGG - Intergenic
1165624073 19:37270441-37270463 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165624619 19:37272982-37273004 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165625162 19:37275509-37275531 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165625696 19:37278047-37278069 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165626236 19:37280572-37280594 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165626774 19:37283099-37283121 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165627317 19:37285620-37285642 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165627858 19:37288148-37288170 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165628395 19:37290672-37290694 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165628931 19:37293197-37293219 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165629478 19:37295723-37295745 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165630019 19:37298248-37298270 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165630562 19:37300776-37300798 GTCAAACGGGTGACTCGGCCAGG + Intergenic
1165631095 19:37303314-37303336 GTCAAACGGGTGACTCGGCCAGG + Intergenic
930728839 2:54709012-54709034 TGCCAGTGGGTGAATCGGCCTGG - Intergenic
932522284 2:72427178-72427200 TGCCAGCGGGTGGCTCGGCCAGG - Intronic
937221045 2:120343587-120343609 TGCCACCGTGGAGCTCGGCCGGG - Intergenic
963718274 3:148829900-148829922 TACCTAGGGGTAACTCTGCCTGG + Intronic
963804969 3:149714049-149714071 TGCCAGCAGGCAACTCGGCCTGG - Intronic
967326845 3:188249353-188249375 TGCCACTGGGTGACTGGGCCTGG + Intronic
984325032 4:178241329-178241351 TGCCAGCGAGTGACTTGGCCTGG - Intergenic
996948050 5:129094237-129094259 AGCCAACAGGTAACTCGTCCTGG + Intergenic
1002419644 5:179138916-179138938 CGCCAGCTGGTAACTGGGCCCGG + Intronic
1045998675 8:108393968-108393990 TGGCAACAGGTAACTAGGGCTGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1189264731 X:39705430-39705452 TGCCAACTGGGAGCTCAGCCAGG - Intergenic
1197728415 X:129791618-129791640 TGCCAGCAGGGAACTCGTCCAGG + Intronic
1198212591 X:134529770-134529792 TGCCAATGGGTAGCCTGGCCTGG - Intergenic