ID: 1146365430

View in Genome Browser
Species Human (GRCh38)
Location 17:32221586-32221608
Sequence CCTTTAAATGCAGGTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146365426_1146365430 -10 Left 1146365426 17:32221573-32221595 CCTGGTAGTGCAGCCTTTAAATG 0: 1
1: 0
2: 1
3: 4
4: 87
Right 1146365430 17:32221586-32221608 CCTTTAAATGCAGGTGGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1146365423_1146365430 26 Left 1146365423 17:32221537-32221559 CCTCCATTTTAAATGCTTTCTCT 0: 1
1: 0
2: 3
3: 59
4: 622
Right 1146365430 17:32221586-32221608 CCTTTAAATGCAGGTGGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1146365424_1146365430 23 Left 1146365424 17:32221540-32221562 CCATTTTAAATGCTTTCTCTTTT 0: 1
1: 0
2: 17
3: 191
4: 1700
Right 1146365430 17:32221586-32221608 CCTTTAAATGCAGGTGGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 130
1146365422_1146365430 27 Left 1146365422 17:32221536-32221558 CCCTCCATTTTAAATGCTTTCTC 0: 1
1: 0
2: 1
3: 60
4: 499
Right 1146365430 17:32221586-32221608 CCTTTAAATGCAGGTGGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146365430 Original CRISPR CCTTTAAATGCAGGTGGTAC AGG Intronic
903416909 1:23189803-23189825 GATTCTAATGCAGGTGGTACAGG + Intergenic
906552543 1:46677526-46677548 CATTCAAATGGAGATGGTACTGG + Exonic
909429156 1:75566384-75566406 GCTTTAACTGCAGCTGGAACTGG - Intronic
909929437 1:81478490-81478512 GCTTTAAGTGCAGCTGGTGCTGG + Intronic
910788852 1:91029877-91029899 ACTTAAAATGCAGGTGGGGCCGG - Intergenic
923982765 1:239343983-239344005 CCTCTAAATGCAGTTGGGGCTGG + Intergenic
1063208242 10:3855100-3855122 ACTTTAAATGTAGGTGGCTCTGG - Intergenic
1065149291 10:22805787-22805809 CCTTCAAATGTAGGTGGGAAGGG - Intergenic
1065298806 10:24302245-24302267 TCTTGAAATGCAGGTCATACAGG - Intronic
1067211913 10:44266521-44266543 ACGTTAAGTGCAGGTGGAACAGG - Intergenic
1077700486 11:4436967-4436989 GCTTTAAATGCAGATGGTGAAGG + Intergenic
1079502711 11:21119729-21119751 CCCTGAAATGGAGGTGTTACAGG + Intronic
1080358290 11:31478561-31478583 ACTTTAAATGCAGGAGTCACAGG + Intronic
1081046753 11:38283229-38283251 CGTTTGAATCCAGGTGGCACAGG - Intergenic
1084882661 11:72182700-72182722 CATTAAAATGCAGTTGATACCGG - Intergenic
1086177092 11:83903872-83903894 CCTGAAACTGCAGGTGGTAATGG + Intronic
1086610039 11:88744582-88744604 CCTTGAAAGGCAGGTGTCACTGG + Intronic
1086764479 11:90677091-90677113 GCTTTATATACAGGTGGTACTGG + Intergenic
1088693092 11:112344424-112344446 CATTTAAAAGGAGGTGATACAGG + Intergenic
1092060321 12:5545617-5545639 CCTTTAAATACAGGAGGAAGAGG - Intronic
1092149632 12:6238637-6238659 CATATAAATGCAGGTGGGGCCGG - Intergenic
1095376753 12:41539007-41539029 GCTATAAATCCAGGAGGTACAGG + Intronic
1097001998 12:55884769-55884791 CATTTGAATCCAGGAGGTACAGG - Intergenic
1098353863 12:69591258-69591280 CCTAGAAAGGTAGGTGGTACTGG + Intronic
1098764588 12:74469838-74469860 GCTGTAAATCCATGTGGTACAGG - Intergenic
1099370411 12:81822411-81822433 CATTCAAATACAGGTGGTAAAGG - Intergenic
1099992560 12:89740626-89740648 CCTTTGAATGTCTGTGGTACTGG - Intergenic
1101197337 12:102397463-102397485 GCTTTAAGTGCATATGGTACAGG - Intronic
1102150749 12:110688044-110688066 CCTTTAACTTCAGGTTGTTCAGG - Exonic
1102546379 12:113659699-113659721 CCTTTAAATGCTGGTGAAAGGGG - Intergenic
1102643123 12:114383833-114383855 CCTTTGATTGCAGGTGGGAATGG + Intronic
1104471244 12:129031633-129031655 CCTTTAAGTTCAGGTGCTTCTGG - Intergenic
1105545548 13:21348175-21348197 CCTTTGAATGCAGGTCTTCCAGG - Intergenic
1105652876 13:22399792-22399814 CCATTAAGTTCAGATGGTACAGG - Intergenic
1106077956 13:26476847-26476869 TCTGAGAATGCAGGTGGTACGGG + Intergenic
1108511874 13:51163629-51163651 CCTTGGAATGCAGGTCATACAGG - Intergenic
1111111884 13:83722063-83722085 CCTTAAAATGCAGGTGTCAAAGG - Intergenic
1113909599 13:113835936-113835958 CATTTAAATGACGGTGCTACAGG + Intronic
1122913107 14:104843405-104843427 CCTGTAAGTGCAGGTGGTGCTGG + Intergenic
1127964023 15:63910488-63910510 CTTTAAAATGCAGTTGGTAGGGG - Intronic
1133161869 16:3917243-3917265 CGTTTTAATCCAGGTGGTTCTGG - Intergenic
1135047156 16:19165358-19165380 CCTTGGAATGCAGGCTGTACAGG + Intronic
1135809724 16:25576309-25576331 CCTTGCAATGCAGGTCGTGCAGG + Intergenic
1141991980 16:87615733-87615755 CCATTCAATGCAGGTGGTGCTGG + Intronic
1143096469 17:4480976-4480998 CCTGTAAAGGCAGGTGGTGGGGG + Intronic
1146365430 17:32221586-32221608 CCTTTAAATGCAGGTGGTACAGG + Intronic
1150451978 17:65276829-65276851 TCATCAAATGTAGGTGGTACAGG + Intergenic
1153551231 18:6263554-6263576 CCTCTAACTGCAGGTAATACTGG + Intronic
1154009827 18:10564981-10565003 CCTTGAAAGGCAGGTGGGTCAGG - Intergenic
1155220423 18:23680318-23680340 TACTTAGATGCAGGTGGTACTGG + Intergenic
928112796 2:28524146-28524168 CCTTTAAAGGGAAGTGGTGCAGG + Intronic
929016166 2:37498036-37498058 CCTTTAAATGCATGTGTTGGAGG - Intergenic
931537665 2:63297259-63297281 CCTTGGAATGCAGGCTGTACCGG - Intronic
931848974 2:66234209-66234231 CCTTGGAATGCAGGTTGTACAGG + Intergenic
932381687 2:71289581-71289603 ACTTGAAATTCAGGTGGTTCAGG + Intronic
933021342 2:77196655-77196677 CCTTTAAATCCAGGAGGTGGAGG + Intronic
937574026 2:123397293-123397315 TCCTTAAATGCACGTGGCACAGG + Intergenic
943218335 2:185069338-185069360 CCTTTAAACACAGGTGGCCCAGG - Intergenic
944226528 2:197354420-197354442 CCTTGGAATGCAGGTTGTATAGG + Intergenic
945511002 2:210702692-210702714 CCTTTAAATGTAGGTGGGGGTGG - Intergenic
945512973 2:210725477-210725499 CCTTTAAACACAGGTGGTGGAGG + Intergenic
945775650 2:214103347-214103369 CAGTGAAATGCAGGTGCTACAGG - Intronic
948389367 2:237601052-237601074 CTTCTAAATGCTGGTGGTAGAGG - Intronic
1170012366 20:11738480-11738502 CCTTTTAAAGGATGTGGTACTGG - Intergenic
1170488614 20:16846727-16846749 CCTTGAAATGTAGGTGCTATTGG - Intergenic
1176666032 21:9688587-9688609 CCTTCAAATGCACGTAGCACAGG + Intergenic
1176700647 21:10044937-10044959 CCATTAAGTCCAGCTGGTACTGG - Intergenic
1177379059 21:20314458-20314480 CCTTGGAATGCAGGCTGTACAGG + Intergenic
1179167821 21:38948268-38948290 CCATGAGATGCAGGTGGCACAGG + Intergenic
1182005701 22:26957696-26957718 TCCTTAAAGGCAGGTGCTACGGG + Intergenic
1182487827 22:30649792-30649814 CCTAGAAATGAGGGTGGTACAGG - Intronic
1184568197 22:45306045-45306067 CCTTGGAATGCAGGCCGTACAGG + Intergenic
1184947681 22:47815809-47815831 CTTTTAAAGGCAGGAGGCACGGG - Intergenic
1185273681 22:49940569-49940591 TTTTTAAATGCAGGTTGTCCAGG - Intergenic
950578339 3:13846623-13846645 CCTATCAAAGCAGGTGGTACAGG - Intronic
952335598 3:32400830-32400852 CCTTTGTATGCAGGTAGAACTGG - Intronic
957122493 3:76113416-76113438 CCTTTTAATGAAAGTGGTAAAGG - Intronic
959824299 3:110774802-110774824 CCTTTAAATGCAAGTGACCCTGG - Intergenic
960181876 3:114589420-114589442 CATTTGGATGCAGGTAGTACTGG + Intronic
960266873 3:115630224-115630246 TCTTTAAATGCATGTAGTGCTGG + Intronic
962185266 3:133252111-133252133 CCTTGAAATTAAGGTGGTTCTGG - Intronic
964052496 3:152412890-152412912 TCTTTAAATGCAGGTGAGAGGGG - Intronic
969648284 4:8446967-8446989 CACTTAAATGCAGGAGGTAGAGG - Intronic
970230913 4:13910001-13910023 CCTACAAATGCAGGTGGGAAGGG + Intergenic
980070092 4:128234753-128234775 CCTTCAAATGCAGTTGTTATAGG - Intergenic
980077426 4:128308532-128308554 CCTTGATATGCTGGTGGTAAAGG - Intergenic
980373007 4:131903396-131903418 CCATTAACTCCAGCTGGTACTGG - Intergenic
982953330 4:161728889-161728911 ACGTTAACTGCAGGTGGTAGCGG - Intronic
984514384 4:180720178-180720200 ACGTTAAAGGCAGGTGGTGCTGG - Intergenic
986718474 5:10540932-10540954 TTTTAAAATGCAGATGGTACAGG + Intergenic
988342214 5:29987186-29987208 CCTTAAAATGCAGTTGATATAGG + Intergenic
989099907 5:37813860-37813882 CCTTTAAATGAAGGTGGTCGGGG - Intronic
990372082 5:55130501-55130523 CTTTTAAATGCTGGGGGTAGGGG + Intronic
990613456 5:57482823-57482845 CCTTTAAATACCTGTGGTCCCGG - Intergenic
995652350 5:114383777-114383799 CTTTTAAATGCATGTGGCACAGG + Intronic
995653163 5:114394853-114394875 TCATTAAAATCAGGTGGTACTGG - Intronic
1000233742 5:159338553-159338575 CCTATAAATGCAGGGGATGCTGG - Intergenic
1002844825 6:936954-936976 GCTTTCAATGCAGGTGACACCGG - Intergenic
1004994865 6:21180297-21180319 GTTTTAAATGAAGGTGGTAGTGG - Intronic
1007000400 6:38306713-38306735 TCTTTAAATATAGCTGGTACAGG - Intronic
1007122796 6:39397291-39397313 GCTTGAAATGCTGGTGGTAATGG + Intronic
1007856008 6:44858401-44858423 CCGTAAAATGGAGGTGGTAATGG - Intronic
1009934033 6:70212192-70212214 TCTTTAAATTCAGGTTGTATTGG + Intergenic
1011053120 6:83176060-83176082 TCTTTAAATGCATGTGTTATAGG - Exonic
1014055271 6:117007271-117007293 CCTTTTGTTCCAGGTGGTACCGG - Intergenic
1015433636 6:133159861-133159883 CCTTCATATGCATGTGATACAGG + Intergenic
1018595597 6:165477222-165477244 GCTTTCCATGCAGATGGTACAGG - Intronic
1020471941 7:8547494-8547516 ATTTTAGATTCAGGTGGTACAGG + Intronic
1024681624 7:51695815-51695837 CTTTTAAATGTTGTTGGTACAGG + Intergenic
1024750967 7:52465368-52465390 CATGCAAATGCAGATGGTACTGG + Intergenic
1025115783 7:56256668-56256690 CCTTGAAATGCAGGCTCTACAGG - Intergenic
1026200230 7:68207874-68207896 CCTTGAAATGCAGGCTCTACAGG - Intergenic
1028171878 7:87607633-87607655 CCTTTGAATGCAGGAGGTTGAGG - Intronic
1028479978 7:91293755-91293777 CCTTTAGAAACAGGAGGTACTGG - Intergenic
1029358234 7:100068898-100068920 CGCTTAAATGCAGGTGGCAGTGG - Intronic
1030403230 7:109079057-109079079 CCTTTAAATACAGGTTCTTCAGG + Intergenic
1030869201 7:114734415-114734437 GCTTTAGAAGCAGGTGGTCCTGG - Intergenic
1034074914 7:148222191-148222213 CCTATAAAGGCAGGCGGTGCTGG - Intronic
1034411500 7:150944696-150944718 CCTCTAAATGCATGTGGTTCAGG + Intergenic
1036040204 8:5070001-5070023 ACTGTAAATAGAGGTGGTACAGG + Intergenic
1039333192 8:36561578-36561600 CCTTTGGGTGCAGGTGGCACAGG - Intergenic
1042824437 8:72965804-72965826 CCATTAAAAGCAGGTGGTAATGG + Intergenic
1045631183 8:104124808-104124830 CCTTTTACTGCAGGTTGGACAGG - Intronic
1052276735 9:26685162-26685184 CTTTTAAATGAAGGTGGCAATGG - Intergenic
1053637792 9:40031428-40031450 CCATTAACTCCAGCTGGTACTGG - Intergenic
1053768289 9:41433794-41433816 CCATTAACTCCAGCTGGTACTGG + Intergenic
1054318586 9:63628032-63628054 CCATTAACTCCAGCTGGTACTGG - Intergenic
1054546958 9:66345297-66345319 CCATTAACTCCAGCTGGTACTGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1062371914 9:136244107-136244129 CATTAAAATGCAGGTGGCCCTGG - Intronic
1202785658 9_KI270719v1_random:15001-15023 CCATTAAGTCCAGCTGGTACTGG - Intergenic
1203660066 Un_KI270753v1:33174-33196 CCTTCAAATGCACGTAGCACAGG - Intergenic
1189884034 X:45521909-45521931 CCCTTGAGTGCAGGTGGAACTGG - Intergenic
1193786242 X:85762755-85762777 ACTTTAGATTCAGGGGGTACAGG + Intergenic
1196692757 X:118577936-118577958 TCTTTGAATGCATGTGGAACAGG - Intronic
1197117183 X:122847538-122847560 GCATCAAATGCAGTTGGTACTGG - Intergenic
1197401141 X:125992356-125992378 CCCTGACCTGCAGGTGGTACTGG - Intergenic
1198491584 X:137146857-137146879 CCTTTAGATGCAGGTGCTGAAGG - Intergenic
1202340682 Y:23862012-23862034 CCTTAGAATGCAGATGCTACTGG - Intergenic
1202530084 Y:25808070-25808092 CCTTAGAATGCAGATGCTACTGG + Intergenic