ID: 1146366503

View in Genome Browser
Species Human (GRCh38)
Location 17:32233057-32233079
Sequence TTGTTAACACAGATTTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 388}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146366503 Original CRISPR TTGTTAACACAGATTTTGCT GGG (reversed) Intronic
901367384 1:8764480-8764502 TAGTTAACAGAGATTATACTTGG - Intronic
902253369 1:15171066-15171088 TTGTTAAAACATAGATTGCTGGG + Intronic
902522128 1:17025043-17025065 TTCTTATTACAGATTTTTCTAGG - Intronic
902740981 1:18437810-18437832 TTATTAACACAGAATTTCCCAGG - Intergenic
903054191 1:20623849-20623871 CTGTAAACACAGTTTTTGATGGG + Intergenic
905355937 1:37384683-37384705 TTGTTAAAACAAATATTGTTGGG - Intergenic
906849381 1:49231514-49231536 TTGCTGAGACAGATCTTGCTTGG - Intronic
906983977 1:50663325-50663347 TTATTAAAACAGAGATTGCTGGG - Intronic
907564154 1:55419118-55419140 TTGAAAACACAGTTTTTACTGGG - Intergenic
908171036 1:61504997-61505019 TTGTTAAAACACAGATTGCTGGG - Intergenic
908918565 1:69162318-69162340 TTTTTAACCCAGGTATTGCTGGG + Intergenic
909771802 1:79432454-79432476 CTGTGAACACAGAGTTTCCTGGG + Intergenic
910301174 1:85708720-85708742 TGGTTAACACAGATTAGGGTGGG - Intergenic
911099812 1:94086637-94086659 TTGTTAACATTGATTATCCTTGG - Intronic
912548851 1:110471256-110471278 TTGTAAATACAGTTTGTGCTGGG - Intergenic
912820543 1:112864352-112864374 TTTTTAAAAAAGATTTTGATTGG - Intergenic
912977180 1:114341383-114341405 TAGATAACATAGATTTTGCTGGG - Intergenic
914915586 1:151817241-151817263 TTGTCCCCACAGATTTTGCAAGG + Exonic
915799107 1:158769665-158769687 TTGTTTACTCTGATTTTTCTTGG + Intergenic
916390963 1:164330497-164330519 TTGTTAAAATTGAGTTTGCTGGG - Intergenic
917189796 1:172403024-172403046 TTGTTAAAACACAGGTTGCTGGG - Intronic
919936584 1:202254931-202254953 TTGAAAAGACAGTTTTTGCTAGG + Intronic
921027228 1:211297012-211297034 TTGATAAGACACATTTTCCTAGG - Intronic
921624381 1:217362226-217362248 TTGTAAACACAGACTTTTCTTGG - Intergenic
922783426 1:228271322-228271344 TTCTTCACACAGATCTTGCAAGG - Intronic
924262337 1:242245028-242245050 TTGTCAATACTGATTATGCTGGG + Intronic
1063238857 10:4147500-4147522 TTGGCAACACATAGTTTGCTGGG + Intergenic
1063400691 10:5742226-5742248 TTATAGACACATATTTTGCTGGG - Exonic
1065518288 10:26546327-26546349 TTGTTAAGACACACATTGCTAGG + Intronic
1067526772 10:47043956-47043978 TTGTTTACACACATTTTTTTGGG - Intergenic
1067674050 10:48354533-48354555 TTGTTAAAACAAAGATTGCTGGG + Intronic
1068503902 10:57875124-57875146 TTGTTAAAACACAGATTGCTGGG - Intergenic
1069138568 10:64796026-64796048 CTTTTCCCACAGATTTTGCTTGG + Intergenic
1069210456 10:65752106-65752128 TTGTTAAAACATGTATTGCTTGG - Intergenic
1069665590 10:70154754-70154776 TTGTTAACATAAATGTGGCTGGG - Intronic
1070028611 10:72655654-72655676 TTGTTAAAACACAGGTTGCTGGG + Intergenic
1070170357 10:73928210-73928232 TTGTTAAAACACAGATTGCTAGG - Intergenic
1070920009 10:80178641-80178663 TTGTTAAAACACAGATTGCTGGG + Intronic
1071062199 10:81585217-81585239 TTGTTACTATAGATTTTCCTAGG - Intergenic
1071157248 10:82705396-82705418 TTGTTAACAAACAGATTGCTGGG - Intronic
1072415116 10:95240925-95240947 TTGTTAACACACAGATTGCTGGG + Intronic
1072448033 10:95516264-95516286 TTGTTAAGACACAGATTGCTGGG - Intronic
1074267880 10:111923298-111923320 CTGTTAACACAGACTTTGTGAGG - Intergenic
1074329345 10:112489064-112489086 TTGTTAATACACAGGTTGCTGGG + Intronic
1074343251 10:112655182-112655204 TTGTTAAAACACAGATTGCTGGG - Intronic
1074461300 10:113639693-113639715 TTGATTGCACACATTTTGCTTGG + Intronic
1074732349 10:116392563-116392585 TTGTTAAAACACAGATTGCTGGG - Intergenic
1074759067 10:116652067-116652089 TTCTTAACACTGCTTTAGCTAGG + Intergenic
1075513509 10:123091475-123091497 TTATTGTGACAGATTTTGCTGGG + Intergenic
1079051515 11:17164808-17164830 TTGATTACCCAGATCTTGCTAGG + Intronic
1079154470 11:17931855-17931877 TTGTTAAAACACAGATTGCTGGG - Intronic
1079679933 11:23282817-23282839 TTGTTAATATAGAGTTTGATTGG - Intergenic
1081015983 11:37881343-37881365 TAAATAACACAGATTTTTCTTGG + Intergenic
1084130809 11:67132852-67132874 TTGTTAAAACACAGATTGCTAGG - Intronic
1086006079 11:82038195-82038217 TAGTTAACACACATTAGGCTTGG + Intergenic
1086438829 11:86807885-86807907 TTCATAAGACAGATATTGCTTGG - Exonic
1086576437 11:88343402-88343424 TTGTTAAAACACAAATTGCTGGG - Intergenic
1086696041 11:89846839-89846861 TTATTAAGATAGGTTTTGCTGGG + Intergenic
1086710114 11:89997650-89997672 TTATTAAGATAGGTTTTGCTGGG - Intergenic
1086813479 11:91339416-91339438 TTCTTAGCACTGCTTTTGCTGGG - Intergenic
1087206070 11:95395202-95395224 TAGTTATCACAGATATTACTAGG - Intergenic
1087450881 11:98322857-98322879 TAGTTAACACTGATTTTGTATGG + Intergenic
1087679226 11:101200533-101200555 TTGTTAAAACAGAGATTGCTGGG - Intergenic
1087973348 11:104513242-104513264 TTTTTAAAACAAATTTTACTGGG + Intergenic
1088563142 11:111135889-111135911 TTGTTAAACCAGACATTGCTGGG + Intergenic
1090167761 11:124569702-124569724 TTGTTAATACATAGATTGCTGGG + Intergenic
1090365774 11:126203996-126204018 TTGTTTATTCAGATTTTGTTGGG - Intronic
1091504390 12:1052114-1052136 TTGTTAAAACACAGATTGCTGGG + Intronic
1093398665 12:18715340-18715362 TTCTTAATAAAGATTTGGCTTGG - Intronic
1093650739 12:21642553-21642575 TTGCTACCACAAATTTTTCTGGG + Intronic
1093837499 12:23852851-23852873 TTGTTAACTCAGATTTGGTTGGG - Intronic
1094488884 12:30946314-30946336 TTGTTAAAACACAAATTGCTGGG - Intronic
1094754464 12:33450595-33450617 TTGTTAAAACATAATTTGCTAGG + Intergenic
1095858716 12:46890748-46890770 TTCTTAAAACACAGTTTGCTGGG - Intergenic
1097567797 12:61293141-61293163 TTATTAAGACACATATTGCTGGG + Intergenic
1097731372 12:63131983-63132005 TTGTTAAAACACAGATTGCTGGG + Intergenic
1098485716 12:71019302-71019324 ATGTTAATACACATATTGCTGGG + Intergenic
1098869287 12:75799002-75799024 TGATTAACACATATTTTGCATGG + Intergenic
1100423302 12:94458918-94458940 TTGTTTACAGACATGTTGCTTGG + Intronic
1102094922 12:110230726-110230748 TTATAAAAACAGATTTTGCATGG + Intergenic
1103969709 12:124662555-124662577 TTGCTAAAACAGCTTTTGCCAGG + Intergenic
1104180125 12:126371698-126371720 TTCTTAACAGAGATTTTACAAGG + Intergenic
1104246939 12:127052544-127052566 TTTTTAACACTGCATTTGCTTGG + Intergenic
1104469584 12:129018788-129018810 TTTTTGACACAGTTTTTGTTGGG - Intergenic
1104794681 12:131509239-131509261 TTGTTAAAACATAGATTGCTGGG + Intergenic
1105339616 13:19508261-19508283 TTGTGAACTCAGATTTTGTGTGG - Intronic
1106280548 13:28264831-28264853 TTGTTAAAATATAGTTTGCTGGG - Intronic
1106425777 13:29627755-29627777 TTCTTAACACTGCTTTAGCTGGG - Intergenic
1107370360 13:39739244-39739266 TTGTAAAAACTGATTTAGCTTGG - Intronic
1107446535 13:40474472-40474494 TTGTTAAAACGGATTTTACAAGG + Intergenic
1109280025 13:60345176-60345198 TTGTTAAAACACACATTGCTAGG - Intergenic
1110400575 13:75086276-75086298 ATGCTAACTCAGATTTTGATGGG - Intergenic
1110624380 13:77635921-77635943 TTGTTAAAACACAGGTTGCTGGG - Intronic
1111898539 13:94171624-94171646 TTGTAAAAAGGGATTTTGCTAGG + Intronic
1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG + Intergenic
1113455679 13:110446854-110446876 TTGTTCACACACCTTTTGCTAGG - Exonic
1115400109 14:32948134-32948156 TTGTTAAAACTAATTTTGTTAGG - Intronic
1116461001 14:45173908-45173930 TTGATTGCACACATTTTGCTGGG - Intronic
1116588710 14:46743566-46743588 TTGTTAAAACACAGATTGCTGGG - Intergenic
1116745556 14:48814319-48814341 TTTTTCACATACATTTTGCTGGG - Intergenic
1118063394 14:62165002-62165024 TTGTTAACACTCAGATTGCTGGG - Intergenic
1119587233 14:75847793-75847815 TTGTTAACACACAGATTGCTGGG + Intronic
1119631831 14:76238810-76238832 TTGTTAAAACACAGATTGCTGGG + Intronic
1119816223 14:77570815-77570837 GTGTAAAAGCAGATTTTGCTAGG - Intronic
1120470284 14:84914908-84914930 TTGTTTGTACAGATTTTTCTTGG + Intergenic
1120677013 14:87432256-87432278 TTGTTAACATACAAATTGCTGGG + Intergenic
1121455124 14:94033539-94033561 TAGTTAACACTGCTTGTGCTTGG - Intronic
1121460315 14:94071176-94071198 TTGTTAACCCACTTTTTGATGGG - Intronic
1123881856 15:24684192-24684214 TTTTTAGCAGAGATTTTGTTTGG - Intergenic
1124052127 15:26206806-26206828 TGGTGAACACAGAATATGCTAGG - Intergenic
1125667126 15:41440042-41440064 CTGTTAACAAATATTTTCCTAGG - Intronic
1126168342 15:45672919-45672941 TTGTTAAAACACAGATTGCTGGG + Intronic
1126571319 15:50155453-50155475 TTGTAAACACACATTTTTCCTGG - Intronic
1127290712 15:57568317-57568339 ATGTTAACACAGAGAATGCTTGG - Intergenic
1128865687 15:71114056-71114078 TTGATCAAACAGATTTTGATGGG - Intronic
1129479820 15:75814811-75814833 TTGCTTACACAGAGTTTCCTTGG + Intergenic
1130234623 15:82122881-82122903 TTGTTAAAACACAGCTTGCTGGG + Intergenic
1130380514 15:83368168-83368190 TTGTTAAAACACAAATTGCTGGG - Intergenic
1130911864 15:88276345-88276367 TTGTTAAAACACAGATTGCTGGG + Intergenic
1131552563 15:93370200-93370222 CTTTTAACTCAGTTTTTGCTTGG - Intergenic
1131733817 15:95311191-95311213 TTATTAATACAGATTTTTCCAGG + Intergenic
1133660466 16:7911362-7911384 TGGTTAAAACACATTTTGCATGG + Intergenic
1133846546 16:9459264-9459286 TTGTTAAATCAGATTCTGCAAGG - Intergenic
1134889235 16:17824206-17824228 TTGCTAATACGGATTTTCCTGGG - Intergenic
1135158045 16:20071210-20071232 ATGTTAATCCAGATTCTGCTGGG - Intronic
1135527231 16:23223262-23223284 GTGTTAACACAGGTGTTGCATGG + Intergenic
1135984949 16:27177247-27177269 CTGTTAACACACAGATTGCTGGG - Intergenic
1136401871 16:30023697-30023719 CTGTTGTCACAGAGTTTGCTTGG + Exonic
1137855113 16:51786728-51786750 TTGTAAACATAGATTTTGCATGG + Intergenic
1138823851 16:60294522-60294544 TTGTAAAAACACATGTTGCTGGG + Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1140129579 16:72148690-72148712 TTGTTAACTCATTTTTTACTGGG - Intronic
1140628428 16:76822615-76822637 TTGTTAAAACACAAATTGCTGGG + Intergenic
1141751932 16:85964279-85964301 TTGTTAACACAGCTATTTATCGG + Intergenic
1144106172 17:11987743-11987765 TTGTTAAGCAAGATGTTGCTTGG - Intronic
1144108101 17:12004356-12004378 ATGTTAAGAAACATTTTGCTAGG - Intergenic
1144811523 17:18003142-18003164 TTGTTCACACAGATTCCCCTTGG + Intronic
1145194239 17:20873812-20873834 TTATTAATCCAGTTTTTGCTAGG + Intronic
1145734647 17:27219220-27219242 TTGTTAAAACACAGATTGCTAGG + Intergenic
1146366503 17:32233057-32233079 TTGTTAACACAGATTTTGCTGGG - Intronic
1148002259 17:44396462-44396484 ATGTTAAAACATTTTTTGCTGGG - Intronic
1148037767 17:44681012-44681034 TTGTTAAAACACAGATTGCTGGG - Intronic
1148499116 17:48075628-48075650 TTGTAAACATTGATTTTGCTTGG - Intronic
1148699856 17:49580835-49580857 TTGTTAACACACAGATTTCTGGG + Intronic
1150501410 17:65654215-65654237 TTCTTAAAACGGATTTTTCTTGG - Intronic
1153279939 18:3405367-3405389 TTGTTGGTACAGATTTTCCTTGG - Intergenic
1153301958 18:3599067-3599089 TTTTAAACACAGTCTTTGCTGGG - Intronic
1153616176 18:6936355-6936377 TTTTTAGCAAAGATTTTACTGGG + Intergenic
1155568777 18:27167021-27167043 TTGTTTGCACAGATTTTCCTGGG + Intronic
1156066953 18:33154238-33154260 TTGTTGACTCAGCTTTTTCTTGG + Intronic
1157239491 18:45996347-45996369 TTATTAGCACAGAGATTGCTGGG + Intronic
1159826435 18:73218135-73218157 TTATTAACACAGAACTTGCAGGG + Intronic
1164955658 19:32381308-32381330 TTGTCAAAACAGAATTGGCTGGG + Intronic
1166257116 19:41614735-41614757 TGGTAATCACAGATTTTGCAGGG - Intronic
925105647 2:1288719-1288741 ATGTTTACACACATTTTCCTTGG - Intronic
925126388 2:1460375-1460397 TTTTTTGCACAGATTCTGCTGGG - Intronic
925818206 2:7773934-7773956 TTGTTAAAACACAGCTTGCTGGG - Intergenic
926625075 2:15084467-15084489 TTTCTAACACTGATTTTTCTGGG - Intergenic
926813886 2:16781340-16781362 TTTTTATCTAAGATTTTGCTTGG - Intergenic
927553858 2:24019317-24019339 TTGTTAACATAGAGATTGCTGGG - Intronic
928275813 2:29899147-29899169 TTGTTAACACAGGCATTGCTGGG - Intronic
929440495 2:41962570-41962592 TTGTTAAAACAAAAATTGCTGGG - Intergenic
929773782 2:44915093-44915115 TTGTTAAAACACAGTTTGCTGGG - Intergenic
930603203 2:53465799-53465821 TTGTTAAAACACAGGTTGCTGGG - Intergenic
930773372 2:55149811-55149833 TTGTTAACACACAGCTTGCTGGG - Intergenic
930804726 2:55479063-55479085 TGGTTAAAACACATATTGCTGGG + Intergenic
933455468 2:82514394-82514416 TTGTTAAAATAAACTTTGCTTGG - Intergenic
934583779 2:95470251-95470273 TTATTAGCATAGGTTTTGCTTGG - Intergenic
934595673 2:95606463-95606485 TTATTAGCATAGGTTTTGCTTGG + Intergenic
934787102 2:97019026-97019048 TTATTAGCATAGGTTTTGCTTGG - Intergenic
935623456 2:105148385-105148407 TTGTTAAAACATAGATTGCTAGG - Intergenic
935779345 2:106497907-106497929 TTGTTTAAACTGATGTTGCTGGG - Intergenic
937473196 2:122191112-122191134 TTGTTCACACACAGATTGCTGGG + Intergenic
939648376 2:144730432-144730454 TTTTTAAATCAGTTTTTGCTGGG + Intergenic
940328044 2:152445629-152445651 TTGTTAAAACATAGATTGCTGGG + Intronic
940984400 2:160038314-160038336 TTGTTAAAACACAGATTGCTGGG + Intronic
941284978 2:163599702-163599724 TTGTTAAAACAAAGTTTCCTGGG - Intronic
941361105 2:164552245-164552267 TTCTTAAAAGAGTTTTTGCTAGG - Intronic
941722330 2:168825052-168825074 TTTTTAAGAATGATTTTGCTGGG - Intronic
943121949 2:183747449-183747471 TTGTTTTCAAAGGTTTTGCTTGG + Intergenic
943759309 2:191591268-191591290 TTGTTAACACACAGATGGCTGGG - Intergenic
943850010 2:192707724-192707746 TTGTGAAAAAAGATGTTGCTTGG - Intergenic
944734015 2:202544664-202544686 ATCTTTACACACATTTTGCTTGG + Intronic
945187189 2:207151171-207151193 TTGATAACACAGAATTACCTCGG - Intronic
945260630 2:207840007-207840029 TTGTTAAAACACAGATTGCTGGG - Intronic
947041421 2:225925264-225925286 TTGGTAACAATGATTTTGCCTGG + Intergenic
947344362 2:229175345-229175367 TTGTTTACTCAGTGTTTGCTCGG - Intronic
947469128 2:230384248-230384270 TTGTTAACAAATATTCTCCTAGG - Intronic
947523306 2:230864584-230864606 TTGTTAACCCAGTGTTTGCCAGG - Intergenic
947745933 2:232507328-232507350 TTGTTTACACAGACATGGCTGGG - Intergenic
1168863413 20:1062893-1062915 TTGTTAACACATAGATTGCTGGG + Intergenic
1169714836 20:8603661-8603683 TTGTTAAAACACACATTGCTAGG - Intronic
1169946658 20:10996418-10996440 CTGTTAACACATAGCTTGCTGGG - Intergenic
1171410214 20:24941867-24941889 TGGTTAATACAGATTTTGTCAGG - Intergenic
1171957877 20:31473829-31473851 TTGTTAAGCCACATTTTGCCGGG - Intronic
1171964566 20:31519630-31519652 TTGTTAAAACACACATTGCTGGG - Intronic
1172152832 20:32802504-32802526 TTGTTATCACATATTTAACTTGG - Intronic
1172157001 20:32833986-32834008 CAGTTAACACAGAATTTACTGGG + Intronic
1172587705 20:36096103-36096125 TTGTTAAAACATAGATTGCTGGG - Intronic
1174505130 20:51012660-51012682 TGGTTCACAAATATTTTGCTTGG + Intronic
1174683671 20:52432766-52432788 TTTTTAAAATATATTTTGCTTGG - Intergenic
1174732828 20:52934910-52934932 TTGTTAAAACACAGATTGCTGGG + Intergenic
1175626874 20:60496014-60496036 TTTTTAAAACATATTTTTCTTGG + Intergenic
1177327757 21:19614230-19614252 ATGTTAACACTGACTTTGTTTGG - Intergenic
1177525253 21:22282547-22282569 TTATTTGCACAGATTTTCCTGGG - Intergenic
1179416371 21:41201785-41201807 CTGTCAACACAGATTTTCTTCGG - Intronic
1181845249 22:25702025-25702047 CTTTTAAAACAGATTTTGATTGG - Intronic
1182575542 22:31270595-31270617 TTGTTGACAAACATTTTGGTAGG + Intronic
1184299996 22:43552912-43552934 TTGCAAATACAGAGTTTGCTCGG + Intronic
949422196 3:3877965-3877987 TTGTTCAATCAGATTTTGGTAGG + Intronic
949589609 3:5480397-5480419 TTGTTAAAACATAGATTGCTGGG + Intergenic
949744261 3:7270016-7270038 TTGTTAATACACCTATTGCTAGG + Intronic
950244278 3:11401171-11401193 TTGTTAAAACAGAAGTAGCTGGG - Intronic
950874360 3:16256622-16256644 TTGTTAAAACACAGGTTGCTGGG + Intergenic
951044530 3:18023234-18023256 TTGTTAAAACACAGATTGCTGGG - Intronic
951728720 3:25787083-25787105 TTGTTACCACACAGATTGCTGGG - Intronic
952042279 3:29275354-29275376 TTGTTACCAGAGATTATCCTAGG - Intergenic
952688680 3:36178074-36178096 TTGTTTACACATATTTTGGGGGG - Intergenic
952778271 3:37067932-37067954 TTGTTAGCCCAGATGATGCTAGG + Intronic
952853673 3:37750051-37750073 TTGTTAAAACACATTTTGGTGGG - Intronic
954262616 3:49450504-49450526 TATTTAACAAATATTTTGCTGGG + Intergenic
954642951 3:52112990-52113012 TTGTTAAAACACAGCTTGCTGGG - Intronic
955055246 3:55448745-55448767 CTGTTACAACAGATTTTTCTTGG - Intergenic
955254869 3:57320764-57320786 TTGTTCAAACACATCTTGCTGGG - Intronic
955838402 3:63084360-63084382 TTGTTAAAACATACTTTCCTGGG + Intergenic
955993983 3:64659070-64659092 TTGTTAACAAAAGCTTTGCTGGG + Intronic
956920087 3:73919010-73919032 TTGTTAACACACAGATTTCTAGG + Intergenic
959051754 3:101531106-101531128 TTGTTAAGACAAAGATTGCTGGG + Intergenic
960354806 3:116638084-116638106 TTTTTAATATATATTTTGCTAGG + Intronic
960599737 3:119444689-119444711 TTGTTAAAACACAACTTGCTAGG + Intronic
962399567 3:135046689-135046711 TTGTTAAGACACAGATTGCTCGG - Intronic
962411409 3:135144382-135144404 TTGTTAAAACACAGATTGCTGGG + Intronic
962524340 3:136223820-136223842 TTGTTAAAGCACAATTTGCTGGG - Intergenic
962556253 3:136555189-136555211 TTGATAAACCAGATTTTTCTAGG - Intronic
962673088 3:137729112-137729134 GTGTTAATACAGCTTTTGCAGGG - Intergenic
963113581 3:141706960-141706982 TTGTTAAAACACAGATTGCTGGG + Intergenic
963328558 3:143889143-143889165 TTGTTAAAACATTTATTGCTGGG - Intergenic
963773945 3:149419839-149419861 TTGTTAAAACAGAGATTGCTGGG - Intergenic
963784693 3:149522723-149522745 TTTAAAACAGAGATTTTGCTTGG - Intronic
964135406 3:153339800-153339822 TTGTTAAAACACAGATTGCTGGG - Intergenic
964989389 3:162788036-162788058 TTGTTAAAACACATATTTCTGGG + Intergenic
965597346 3:170421831-170421853 TTCTTAATACAGTTTTTACTTGG + Intronic
965980516 3:174684348-174684370 TTGTAAACTCATATTTTGCAAGG - Intronic
966402189 3:179559381-179559403 TTCATAAAGCAGATTTTGCTGGG + Intergenic
966551265 3:181206756-181206778 TTGTTAACACAAATTGTATTGGG - Intergenic
969973698 4:11074780-11074802 TTATTAAAACACAGTTTGCTGGG - Intergenic
970360235 4:15302006-15302028 TTTTTCACACAAATTGTGCTGGG + Intergenic
971292517 4:25357843-25357865 TTGTTAAAACACAGATTGCTGGG + Intronic
971364195 4:25964042-25964064 TTGTTTTCACCGATTGTGCTGGG + Intergenic
971431146 4:26569088-26569110 ATGATAATACAGATTTTACTGGG - Intergenic
972346046 4:38193150-38193172 TTGTTAAAACACAGATTGCTGGG - Intergenic
972680624 4:41303568-41303590 TTGTTAAAACACAGATTGCTGGG - Intergenic
972812832 4:42609270-42609292 TTGTTAAAACACAGATTGCTGGG - Intronic
973180007 4:47255692-47255714 TTGTTAAAACACAGATTGCTGGG + Intronic
973232770 4:47861159-47861181 TTGTTAAAACACAGATTGCTGGG - Intronic
973291034 4:48470905-48470927 TTGAGAACAGAGATATTGCTAGG - Intergenic
973576503 4:52295310-52295332 TAGTTAAGAAAGATTCTGCTAGG - Intergenic
973681653 4:53326967-53326989 TTATAAAGACAGATTTTGCTTGG - Intronic
974460035 4:62175402-62175424 TTTTTAACACAGAATTTATTTGG + Intergenic
974674663 4:65074299-65074321 TTTTTAACTCAGAGTTTGCTAGG - Intergenic
976114016 4:81707453-81707475 TTGTTAAAACACAGGTTGCTGGG + Intronic
976573472 4:86639894-86639916 TTGTTAAAACACAAATTGCTGGG - Intronic
977202635 4:94135008-94135030 TTGTTAAAACAGTGATTGCTGGG - Intergenic
977445516 4:97126718-97126740 CTGTTAACACTGCTTTAGCTGGG - Intergenic
978169574 4:105653026-105653048 ACGTTCACACAGATTTTGCCAGG + Intronic
978931794 4:114323101-114323123 TGGTTAACACAGACTAGGCTGGG - Intergenic
979753367 4:124307167-124307189 TTGTTAAAACACAGCTTGCTGGG + Intergenic
981685075 4:147445189-147445211 TTGTTAAAACACATATTGCTGGG - Intergenic
981963346 4:150569409-150569431 TTATTAACACAGCTTTTGTTTGG - Intronic
982042610 4:151410057-151410079 TTGTTAACTCCGCTTCTGCTAGG + Intronic
982300144 4:153869960-153869982 TTGTTAAAACACAGGTTGCTTGG + Intergenic
982345549 4:154353792-154353814 TTGTAAAAACAGAATTTCCTGGG + Intronic
983539128 4:168889752-168889774 TTGTTAAAACACAGATTGCTGGG + Intronic
983601684 4:169536482-169536504 TTGTTAACAAATATTTTGACTGG - Intronic
983716936 4:170793717-170793739 CTGTTAAAACAAAGTTTGCTTGG + Intergenic
984077781 4:175205212-175205234 TTGTTAACGCAGAAATTTCTAGG + Intergenic
985017680 4:185653778-185653800 TCGTACTCACAGATTTTGCTTGG + Intronic
987784761 5:22485868-22485890 TTATTAAGAAATATTTTGCTAGG + Intronic
987881098 5:23747384-23747406 TTGCTAACACCGTATTTGCTGGG + Intergenic
988165521 5:27584423-27584445 TTTTTAAAACAGATTTTTATAGG + Intergenic
988819138 5:34863338-34863360 TTGCTAACACTGATTTTCTTGGG - Intronic
988861491 5:35285025-35285047 TTCTTAACACAGAATTTCATAGG - Intergenic
990090264 5:52036999-52037021 TGGTTAATATACATTTTGCTGGG - Intronic
990541145 5:56773370-56773392 TTGTTAAGACATAGATTGCTAGG + Intergenic
990626812 5:57622706-57622728 TTGTTGACACCGCTGTTGCTGGG + Intergenic
992278012 5:75141029-75141051 TTGTTAAAACACAGATTGCTGGG - Intronic
992481499 5:77156640-77156662 TTGATAACACTGATTCTACTGGG - Intergenic
993213970 5:84995024-84995046 TGGTTAACACAGCTTTTGGATGG + Intergenic
993338334 5:86689843-86689865 TTGTTAAAACACAGATTGCTGGG + Intergenic
993977266 5:94497748-94497770 TTGTTAACACACAGATTGCCAGG + Intronic
994309597 5:98252959-98252981 TTCTTAACAATGAGTTTGCTTGG + Intergenic
994351748 5:98753730-98753752 TTGTTAAAACACAGGTTGCTGGG + Intergenic
995247701 5:109953494-109953516 TTGTTAAAACACAGATTGCTGGG - Intergenic
995978154 5:118067636-118067658 TTGTTAAAACACAAATTGCTAGG - Intergenic
996492463 5:124114338-124114360 TTGTTAAAACACAGATTGCTGGG - Intergenic
996855843 5:128005572-128005594 TTGTTAAAACACAGATTGCTAGG - Intergenic
996923312 5:128793975-128793997 TTGTTTTCACAGTTTTTGCTAGG - Intronic
997039798 5:130238876-130238898 TTATTAACACAGAGTTTGAAAGG - Intergenic
997887288 5:137641579-137641601 GAGTTCACACAGATTTTGATGGG - Intronic
998461258 5:142311829-142311851 TTGTAAACACGGATTTTTCTGGG - Exonic
998508512 5:142691639-142691661 TTGTTAAAACACAGATTGCTGGG + Intronic
998511488 5:142718027-142718049 TTGTTAAACCAGAGATTGCTGGG - Intergenic
998946959 5:147350188-147350210 TTGATAACAGTTATTTTGCTGGG + Intronic
998956562 5:147444680-147444702 CAGTTAACACAGATTTTACCAGG - Intronic
999353527 5:150902069-150902091 TGGTTAACACTGATTATCCTGGG + Intronic
1000247889 5:159464466-159464488 TTGTTAACACACTTTTAGTTTGG - Intergenic
1000365629 5:160488196-160488218 TTGGTAAAACAGAAATTGCTGGG - Intergenic
1000594263 5:163195853-163195875 TTGTTTACTCAGATTTTCTTAGG - Intergenic
1000855817 5:166396629-166396651 TTTTTAACCCAGATGTTGGTTGG - Intergenic
1001012317 5:168109551-168109573 CTGTTAACACACAGATTGCTGGG + Intronic
1001643162 5:173259876-173259898 TTGCTAACACACAGATTGCTGGG + Intergenic
1004100019 6:12599949-12599971 TTTTTAACCCATATTTTACTGGG - Intergenic
1004149373 6:13100953-13100975 TTGTTAAAACTGATGTTCCTGGG + Intronic
1004393112 6:15225798-15225820 TTGTTAAAACACACATTGCTGGG + Intergenic
1004846061 6:19643813-19643835 TTCTTTAGACAGATTTTACTAGG - Intergenic
1005104154 6:22205320-22205342 TGGTTAACAGAGATTTTGGAAGG - Intergenic
1005226381 6:23647978-23648000 TTGTTCACACAGATTAAGATTGG + Intergenic
1006532996 6:34673109-34673131 CTGATATCCCAGATTTTGCTGGG - Intronic
1006535000 6:34691838-34691860 CTGTTAACACATATTTTGTTTGG - Intronic
1007229215 6:40336776-40336798 TTGTGAACACAGATGTGACTTGG + Intergenic
1007730924 6:43945705-43945727 TTGTTTACTCATAATTTGCTGGG + Intergenic
1008042817 6:46819765-46819787 CTGTCCACACAGATTTGGCTTGG - Intronic
1008152453 6:47970879-47970901 TTGTTAAAACAAAAATTGCTAGG - Intronic
1008211278 6:48728487-48728509 TTCTTAACCCCAATTTTGCTAGG + Intergenic
1008653014 6:53582750-53582772 TTGTTAAAACAGGGATTGCTGGG + Intronic
1008802211 6:55382903-55382925 TTTTTATCACAGATTTTGAGGGG + Intronic
1008813365 6:55532867-55532889 ATGTTAACACTGTTTTTGTTGGG - Intronic
1010211834 6:73368278-73368300 TTGTTAAAACACAATTTCCTTGG - Intergenic
1010326319 6:74567088-74567110 TTGTTCACACATTTTTTGATAGG + Intergenic
1010359121 6:74972295-74972317 TTGTTATCTCAGAATTTGCCTGG + Intergenic
1011275863 6:85630887-85630909 ATGATAAAATAGATTTTGCTTGG - Intronic
1012547064 6:100432271-100432293 GTGTTAACACACAGCTTGCTGGG + Intronic
1012700160 6:102446636-102446658 TTGATGACAGAGATTTTACTGGG + Intergenic
1014677732 6:124388367-124388389 TTGTTAAAACAAATGTTTCTGGG + Intronic
1015093977 6:129392410-129392432 TTGTTAATACATGGTTTGCTGGG - Intronic
1015471190 6:133608063-133608085 TTGTTAACATAGGTATTGCTGGG - Intergenic
1015718127 6:136212924-136212946 TTATTTACACAAATTTTTCTGGG - Intergenic
1016031268 6:139340993-139341015 TTCTTGAAACATATTTTGCTTGG + Intergenic
1016127017 6:140416273-140416295 ACATTATCACAGATTTTGCTAGG + Intergenic
1017273915 6:152543261-152543283 TTGCAAAAACAGATTTTACTAGG + Intronic
1017975773 6:159356061-159356083 TTGTTCAGACACATTTTTCTTGG - Intergenic
1018012144 6:159681018-159681040 TTGTTACTACAGATAATGCTGGG - Exonic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1020686549 7:11303074-11303096 TTCTTTACACATATTTTGATTGG - Intergenic
1021398040 7:20174426-20174448 TTTATAACATTGATTTTGCTGGG - Intronic
1021696056 7:23277399-23277421 TGGTTAAAACACATATTGCTGGG + Intergenic
1022170817 7:27827953-27827975 ATGTTAAAACACATATTGCTGGG - Intronic
1022971033 7:35517540-35517562 TTGTTAAAACAGAAATTGCTAGG + Intergenic
1023555724 7:41420904-41420926 ATATTGAAACAGATTTTGCTGGG - Intergenic
1023733879 7:43218079-43218101 TTTTTGACACAGACTTTGTTGGG - Intronic
1024540136 7:50469349-50469371 TTGTTAAAACAGAGGTTGCTGGG + Intronic
1024618194 7:51133549-51133571 TTGTTAAAACACATTTTCCTGGG - Intronic
1024851106 7:53718059-53718081 TTGTTAATACAGATTTTAAGAGG + Intergenic
1024881417 7:54089815-54089837 TTTTTAAGACACATTTTGTTGGG - Intergenic
1026287114 7:68973077-68973099 TTGTTAAAACACAGTTTGCGGGG + Intergenic
1027929632 7:84515403-84515425 GTGGTAAGACAGATTTTGCCTGG - Intergenic
1028678585 7:93497604-93497626 TTGTTAAAACAGAAATAGCTTGG - Intronic
1033770979 7:144551273-144551295 AAGGTAACACAGATGTTGCTTGG + Intronic
1034293811 7:149953307-149953329 TTGTTAACAGTGATTCTGTTTGG + Intergenic
1034812255 7:154143552-154143574 TTGTTAACAGTGATTCTGTTTGG - Intronic
1035121468 7:156571534-156571556 TTGTTGAACCAGATCTTGCTGGG - Intergenic
1036480136 8:9132190-9132212 TTGTTCACACAAATTTTCCAGGG - Intergenic
1036733983 8:11291527-11291549 TTTTTAAAACATATTTTTCTTGG + Intronic
1037339952 8:17833900-17833922 AAGTTAACACAGATTCTGCCTGG + Intergenic
1037470075 8:19199575-19199597 TTGTTAAAACACAGATTGCTAGG - Intergenic
1038076633 8:24082907-24082929 TTGTTAACCCATATTTTCATGGG + Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1041714855 8:60923644-60923666 TTGTTAAAACACAGATTGCTGGG + Intergenic
1042510558 8:69607160-69607182 TTGTTAACACACAGATTGCTGGG - Intronic
1042820693 8:72927007-72927029 TTGTTAAAACACAGATTGCTGGG + Intronic
1043516916 8:81003137-81003159 TTGTTAATACAGAGGTTGCCGGG - Intronic
1043707516 8:83370724-83370746 TTGTTAAAACACAGATTGCTGGG - Intergenic
1043822564 8:84886539-84886561 TTGTTTTCACTAATTTTGCTGGG - Intronic
1044517113 8:93152377-93152399 TTGTGAACTCAGATTTAACTAGG + Intronic
1044751872 8:95423824-95423846 TGTTGAACACAGATTTTCCTTGG - Intergenic
1045068608 8:98477071-98477093 TTGTTTGTACAGATTTTCCTCGG - Intronic
1045183420 8:99811445-99811467 TTGTTAAAACACAGATTGCTGGG + Intronic
1046688034 8:117248941-117248963 TTGTTAAAACACAAATTGCTTGG + Intergenic
1047039468 8:120976757-120976779 TGGGGAACACACATTTTGCTTGG - Intergenic
1048023863 8:130566226-130566248 TTTTTAACCAAGATTTTGGTTGG - Intergenic
1050150710 9:2617007-2617029 TTGTTAAAACATAGATTGCTGGG - Intergenic
1050774254 9:9239991-9240013 TAGCTAACACAGATTTGGATTGG + Intronic
1051342565 9:16125473-16125495 TTGTTAAACCAGCTTCTGCTTGG + Intergenic
1051522652 9:18007149-18007171 TTGTTAACACAGTTTAAGCCAGG + Intergenic
1052555436 9:30008712-30008734 TAGTTAACACATACTTTTCTGGG - Intergenic
1053383648 9:37669414-37669436 TTGTTAAAACACAGGTTGCTGGG - Intronic
1054909306 9:70439250-70439272 TTCTAAACACAGATTTTGGCTGG - Intergenic
1055036928 9:71827476-71827498 TTGTTAAAACATAGCTTGCTGGG + Intergenic
1055117461 9:72621180-72621202 ATTGTAACACAGATTTAGCTTGG + Intronic
1055555499 9:77469348-77469370 TTTTTAACACAGTTTATCCTAGG - Intronic
1055908348 9:81319078-81319100 TTGTGAGCAAACATTTTGCTGGG + Intergenic
1056082273 9:83107889-83107911 TTTTTAAAACAGGTTTTCCTGGG - Intergenic
1056186176 9:84137168-84137190 TTGTTAAAACACATCTTTCTGGG + Intergenic
1056546098 9:87615132-87615154 TTGTTAAACCACATTTTGCAAGG - Intronic
1057247225 9:93466905-93466927 TTGTTAACACAGATTCTGGGAGG + Intronic
1057283463 9:93728977-93728999 TTGTTAACACAGAATTAGGGTGG + Intergenic
1058801483 9:108548595-108548617 TTGTAAACACAGAATTTGCCAGG - Intergenic
1059044867 9:110855565-110855587 TAGTTAGCACAGACTCTGCTAGG + Intergenic
1059543210 9:115151216-115151238 TTGTTAACACACAGATGGCTGGG - Intronic
1187726009 X:22202956-22202978 TTGTTAAAACATAAATTGCTGGG - Intronic
1188283743 X:28302866-28302888 TTGTTAAAACACACATTGCTGGG - Intergenic
1188604798 X:32015272-32015294 TTGTTAACCCACAGTTTTCTTGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189155760 X:38755446-38755468 TTGTTAACACAGAGATGGCCAGG - Intergenic
1190455413 X:50622956-50622978 TTGTTAAAACAGAGATTGCTGGG + Intronic
1190702882 X:53001174-53001196 TTGTTAAAACACAGATTGCTGGG + Intergenic
1191141835 X:57122678-57122700 TTGTTTACAGAGTTTTTGGTTGG - Intergenic
1191668840 X:63730520-63730542 TTGTTAAAACACAGGTTGCTGGG + Intronic
1192017040 X:67342284-67342306 TTGCAAACACAGCTTTTGGTAGG - Intergenic
1193074869 X:77345172-77345194 TTGTTATCACACAGTTTTCTGGG + Intergenic
1193565390 X:83069871-83069893 TTGTCAAGAAACATTTTGCTGGG + Intergenic
1193829116 X:86266143-86266165 TTGTTAAAACACAGATTGCTGGG + Intronic
1194424722 X:93722231-93722253 TTGTTAAAACACATATTACTGGG + Intergenic
1194816609 X:98449237-98449259 TTGTTAAAACACAGATTGCTGGG + Intergenic
1195047265 X:101065377-101065399 TTGTTAAAACACAGATTGCTGGG + Intergenic
1196168716 X:112564218-112564240 TTGTTAAAACACATATTCCTGGG - Intergenic
1196432262 X:115639118-115639140 TAGTAAATACAGATTTTGCTGGG + Intronic
1196548045 X:116988245-116988267 TTGTTAAAACACAGATTGCTGGG + Intergenic
1197009418 X:121542968-121542990 TTTTTAAAACAAATTGTGCTGGG - Intergenic
1197592337 X:128423692-128423714 TTGTTAAAACAAACATTGCTGGG + Intergenic
1197641398 X:128972069-128972091 TTGTTAAGCCAGAATTTGCTAGG - Intergenic
1198774147 X:140161835-140161857 TTGTTAAAACAGAACCTGCTGGG - Intergenic
1202001100 Y:20158087-20158109 TTGTTAATTCAGATTTTTCCAGG + Intergenic
1202592610 Y:26503009-26503031 TTGTGAACACAGATTTTTTGTGG + Intergenic