ID: 1146369310

View in Genome Browser
Species Human (GRCh38)
Location 17:32255190-32255212
Sequence CAAAATCTCTAGTTTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146369303_1146369310 30 Left 1146369303 17:32255137-32255159 CCAATCCGCATGGAGAATGTAGC No data
Right 1146369310 17:32255190-32255212 CAAAATCTCTAGTTTAGGCTGGG No data
1146369305_1146369310 3 Left 1146369305 17:32255164-32255186 CCAAGACAGACATCTTCCCTACT No data
Right 1146369310 17:32255190-32255212 CAAAATCTCTAGTTTAGGCTGGG No data
1146369304_1146369310 25 Left 1146369304 17:32255142-32255164 CCGCATGGAGAATGTAGCAAAGC No data
Right 1146369310 17:32255190-32255212 CAAAATCTCTAGTTTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146369310 Original CRISPR CAAAATCTCTAGTTTAGGCT GGG Intergenic