ID: 1146371165

View in Genome Browser
Species Human (GRCh38)
Location 17:32266227-32266249
Sequence GATGCGCTCCGCCTCGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146371165_1146371176 23 Left 1146371165 17:32266227-32266249 CCTGCGCCGAGGCGGAGCGCATC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1146371176 17:32266273-32266295 GGAGCGGCTGCCCGCGGCGCCGG 0: 1
1: 1
2: 3
3: 22
4: 286
1146371165_1146371174 17 Left 1146371165 17:32266227-32266249 CCTGCGCCGAGGCGGAGCGCATC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1146371174 17:32266267-32266289 GGCCGAGGAGCGGCTGCCCGCGG 0: 1
1: 0
2: 1
3: 29
4: 222
1146371165_1146371169 -4 Left 1146371165 17:32266227-32266249 CCTGCGCCGAGGCGGAGCGCATC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1146371169 17:32266246-32266268 CATCGAGGAGCTGGAACCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1146371165_1146371177 26 Left 1146371165 17:32266227-32266249 CCTGCGCCGAGGCGGAGCGCATC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1146371177 17:32266276-32266298 GCGGCTGCCCGCGGCGCCGGAGG 0: 1
1: 0
2: 3
3: 53
4: 537
1146371165_1146371170 2 Left 1146371165 17:32266227-32266249 CCTGCGCCGAGGCGGAGCGCATC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1146371170 17:32266252-32266274 GGAGCTGGAACCCGAGGCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 279
1146371165_1146371171 7 Left 1146371165 17:32266227-32266249 CCTGCGCCGAGGCGGAGCGCATC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1146371171 17:32266257-32266279 TGGAACCCGAGGCCGAGGAGCGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146371165 Original CRISPR GATGCGCTCCGCCTCGGCGC AGG (reversed) Exonic
900000203 1:10656-10678 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000208 1:10685-10707 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000213 1:10714-10736 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000218 1:10743-10765 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000223 1:10772-10794 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000235 1:10844-10866 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000249 1:10920-10942 GAGGCGCACCGCGCCGGCGCAGG + Intergenic
900019905 1:181165-181187 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019910 1:181194-181216 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019927 1:181281-181303 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019932 1:181310-181332 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
901513580 1:9730595-9730617 GCTGCTCTCCGACTCGGCGCTGG + Exonic
902287683 1:15417161-15417183 GAAGCGCTAAGCCTCGGCTCAGG + Intronic
921866764 1:220094485-220094507 TACGGGCCCCGCCTCGGCGCGGG + Intronic
923171413 1:231421356-231421378 GATGCGCTGAGCCCCGGCGGCGG - Exonic
1064622553 10:17229928-17229950 GTCGCGCTCCACCTCGACGCGGG - Exonic
1073138032 10:101230301-101230323 GCTGCGCTCCGCCCGGGCCCCGG + Intergenic
1077247513 11:1546795-1546817 GCTGCGCTCCGCCTCGGGTTCGG + Intergenic
1080779775 11:35419448-35419470 GCTGCGCTCTGGCTCGGCGCCGG + Intronic
1091108608 11:132944430-132944452 GGTGCACTCCACCTCTGCGCGGG - Intronic
1091372957 11:135076192-135076214 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372962 11:135076221-135076243 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372967 11:135076250-135076272 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372972 11:135076279-135076301 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372977 11:135076308-135076330 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372982 11:135076337-135076359 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091373282 12:10752-10774 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373287 12:10781-10803 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373292 12:10810-10832 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373297 12:10839-10861 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373302 12:10868-10890 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373307 12:10897-10919 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373312 12:10926-10948 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373334 12:11049-11071 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1103074310 12:117969454-117969476 GGTGCGCTCCGGCTGGGAGCAGG + Intergenic
1105074529 12:133264223-133264245 GAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1106172992 13:27304803-27304825 AATGCACTCCCCCTGGGCGCAGG - Intergenic
1202899815 14_GL000194v1_random:28481-28503 GATGCTCTCCGTGTCGGTGCTGG - Intergenic
1124251119 15:28106992-28107014 GATGCGCTTCGCTGCCGCGCGGG + Intergenic
1124848120 15:33311168-33311190 GCTGCGCTGCGCCGCGGTGCCGG + Intronic
1129675996 15:77632679-77632701 GGCGCGCTCCGCCGCGGGGCCGG + Intronic
1132453258 15:101980025-101980047 GAGGCGCACCGCGCCGGCGCAGG - Intergenic
1132453272 15:101980101-101980123 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1132453285 15:101980174-101980196 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1132453290 15:101980203-101980225 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1132556451 16:574852-574874 GATGCGCTCTTCCTGGGCCCGGG + Intronic
1132947175 16:2538093-2538115 CATGGGCCCCGCGTCGGCGCGGG - Exonic
1140529017 16:75648182-75648204 GCTGGGCCCCGCCTCGGCGGCGG + Exonic
1141615705 16:85208274-85208296 GATGCACTCCGCCACGTCGCTGG + Intergenic
1142206416 16:88785156-88785178 GCTGCGCTCCGCCGAGGGGCAGG - Exonic
1143483438 17:7239564-7239586 GGTGCACTGCGCCTCGGCGCCGG - Intronic
1146371165 17:32266227-32266249 GATGCGCTCCGCCTCGGCGCAGG - Exonic
1148341786 17:46877588-46877610 GTTGCCCTCCTCCTCTGCGCTGG - Intronic
1154255459 18:12777644-12777666 GAAGGGCCCCGCCTCGGAGCGGG - Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1164624062 19:29715090-29715112 GAGGCGCCCCGCCCCGGCTCCGG + Intronic
1165040573 19:33065023-33065045 GACGCGCCCCGCCCCGTCGCGGG + Intergenic
1166379856 19:42350267-42350289 AATGGGCTCCGCCCTGGCGCAGG - Exonic
927085679 2:19672265-19672287 GATTCTCTCCGCCTCTGGGCTGG + Intergenic
936569407 2:113602197-113602219 GAGGCGCGCCGCGCCGGCGCCGG - Intergenic
937908423 2:127064001-127064023 GATGAGCTCCTCCTCGGCCTGGG + Exonic
941666473 2:168247700-168247722 GCTGTTCTCCGCCTCGGCGAGGG + Exonic
942452613 2:176117654-176117676 GTCGGGCTCCGGCTCGGCGCTGG - Intronic
947765305 2:232633850-232633872 GCTCAGCTCCGCGTCGGCGCTGG - Exonic
948761048 2:240191212-240191234 GCTGAGCACCGCCTTGGCGCTGG + Intergenic
948824718 2:240568618-240568640 GACGGGCGCGGCCTCGGCGCCGG - Intronic
1169129678 20:3159651-3159673 GATGCGCTCCAGCTCTGGGCCGG + Intronic
1176619189 21:9043255-9043277 GATGCTCTCCGTGTCGGTGCTGG - Intergenic
1183912897 22:41092260-41092282 GGTGGGCTCCGCGTCGGCGCGGG + Exonic
950618128 3:14178636-14178658 CAAGCGCACCGCCTCGGGGCGGG - Exonic
956678225 3:71754478-71754500 GGTGTGCGCCGCCTGGGCGCTGG + Exonic
959163003 3:102741835-102741857 GATCCGCTCGGCCTGGGGGCAGG + Intergenic
968520408 4:1032458-1032480 GATGCTCTCTGCCTCAGGGCTGG + Intergenic
968943153 4:3649825-3649847 GGTGAGCTCCGCCTCGATGCAGG - Intergenic
973317624 4:48779277-48779299 GCTGCTCTCAGCCTCGGCACCGG - Intronic
985467609 5:12489-12511 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467614 5:12518-12540 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467619 5:12547-12569 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467624 5:12576-12598 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467629 5:12605-12627 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467634 5:12634-12656 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467639 5:12663-12685 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467644 5:12692-12714 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467649 5:12721-12743 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467654 5:12750-12772 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467659 5:12779-12801 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467664 5:12808-12830 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
991587436 5:68215420-68215442 GAACCCCTCCGCCTCTGCGCTGG + Intergenic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
998849954 5:146342914-146342936 GGAGCGCTTCGCTTCGGCGCGGG - Intergenic
1003624278 6:7727795-7727817 CATGCGCTCCCCCGCGCCGCGGG + Intronic
1026935818 7:74254671-74254693 GATCCGCTCCGCGGCGGCGTGGG + Intergenic
1039493714 8:37965903-37965925 GCAGCGCTGCGCCTCGGCGTCGG + Exonic
1049883039 9:10993-11015 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1049883044 9:11022-11044 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1061811214 9:133163650-133163672 GATGCGCACCTCCTGGGCTCAGG + Intronic
1062454021 9:136627294-136627316 GATGGGCTCAGACTCGGCACTGG - Intergenic
1187067296 X:15854204-15854226 AATGGGCTCAGCCGCGGCGCGGG + Intronic
1200402757 X:156029119-156029141 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402762 X:156029148-156029170 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402767 X:156029177-156029199 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402772 X:156029206-156029228 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402777 X:156029235-156029257 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402782 X:156029264-156029286 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402787 X:156029293-156029315 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402792 X:156029322-156029344 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic