ID: 1146372082

View in Genome Browser
Species Human (GRCh38)
Location 17:32271107-32271129
Sequence CTGAATCAACAGAAGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146372082 Original CRISPR CTGAATCAACAGAAGGAATC AGG (reversed) Intronic
900433806 1:2617034-2617056 CTTAATCATCACAAGGAAGCTGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
901837989 1:11936457-11936479 CTGTATCACCAGAAGGATCCCGG + Intronic
905120381 1:35677317-35677339 TTTAAGCAAAAGAAGGAATCAGG + Intergenic
906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG + Intergenic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907595868 1:55719267-55719289 CTGAAACCAGAGAAGGAACCTGG - Intergenic
908960353 1:69690352-69690374 CTCAATAACTAGAAGGAATCAGG + Intronic
909233477 1:73121042-73121064 CTGAATCAACAGAAAAAAATGGG + Intergenic
911752666 1:101515535-101515557 CTGAATCAAAAGAACAAAGCTGG - Intergenic
913150491 1:116037528-116037550 CTGAAGCAAAGGAAAGAATCTGG - Intronic
914768544 1:150661955-150661977 TTGAATGAAGTGAAGGAATCAGG - Intronic
916290631 1:163162396-163162418 CTGAATCAGCAGAGGGCATTGGG + Intronic
916763066 1:167834301-167834323 CTCCATCAAGAGAATGAATCTGG + Intronic
918375890 1:183908726-183908748 CTGAGGCAGCAGAAGGAATTGGG + Intronic
918537835 1:185594101-185594123 CTGAATAAAAAGAAGGAATCAGG - Intergenic
920227469 1:204449031-204449053 CTGAAGCAACTGAGGGAATATGG - Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921646284 1:217622235-217622257 CTGAATCAACACAAGGGACAGGG + Intronic
922284851 1:224161752-224161774 CAGACACAACAGAAGAAATCTGG - Exonic
924638864 1:245814342-245814364 CTGAAGCAGCACCAGGAATCAGG + Intronic
1064063862 10:12163626-12163648 CCCAAGCAAAAGAAGGAATCTGG - Intronic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1065562831 10:26980716-26980738 CTCACTCAACAGAAGGCAACAGG - Intergenic
1065563871 10:26989769-26989791 CTCATTCAACAGAAGGCAGCAGG - Intergenic
1065564938 10:26998824-26998846 CTCACTCAACAGAAGGCAGCTGG - Intronic
1067082365 10:43218901-43218923 TTGAATTGACTGAAGGAATCTGG + Intronic
1067251587 10:44591199-44591221 CTTAAATAACAGAAGCAATCTGG - Intergenic
1069010499 10:63366579-63366601 CTGAATGAAGAGAAAGAATGAGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1074624982 10:115173061-115173083 CTGAGAAAACAGAAGTAATCAGG + Intronic
1074863347 10:117530005-117530027 CTGAAAAAAAAGAAGGAATTAGG - Intergenic
1076188243 10:128465162-128465184 CTGAATCAAGAGATAGAAGCCGG - Intergenic
1076431479 10:130406764-130406786 CTGATTCAAAAGAAGGAAAGAGG + Intergenic
1078129032 11:8596651-8596673 CTGAATGATGAGAAGGAACCAGG - Intergenic
1078614198 11:12849796-12849818 CTGAATAAATAGCAGGAATGAGG - Intronic
1079217559 11:18527062-18527084 CGGAATCAGCAGGACGAATCGGG + Exonic
1080589445 11:33708720-33708742 CGGCATCAACAGAAGAAAGCTGG + Exonic
1082604063 11:55201650-55201672 CTCAATCAAAAGAAAGATTCAGG + Intergenic
1085782176 11:79419448-79419470 CTGACTCATCAGAAGGTAACTGG + Intronic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1086776358 11:90838606-90838628 TTGAATCAACAGAAGGTATTTGG - Intergenic
1086778195 11:90866627-90866649 CTGTATCTAAAGAAGGCATCAGG + Intergenic
1088299995 11:108347631-108347653 CAGATTCAAAAGAAGGAATCAGG + Intronic
1088420957 11:109646268-109646290 CTAGATCAACAAAAGGAATCAGG + Intergenic
1090169151 11:124582905-124582927 CTGTACCAACAGAAAGAGTCTGG - Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1096218353 12:49810676-49810698 CTGACTTAATAGAAGGAAGCTGG - Intronic
1097292683 12:57932173-57932195 CTGAATCAAGTGTAGGAATGGGG + Intergenic
1098119399 12:67220235-67220257 CTGAATCATCAGAGGCAAGCTGG - Intergenic
1099532004 12:83793993-83794015 TTGAAACAAGAGAAGAAATCAGG - Intergenic
1100271800 12:93032611-93032633 CTTGAACAAAAGAAGGAATCAGG + Intergenic
1102088533 12:110165211-110165233 CTAAAAGAACAGAAGGTATCGGG + Intronic
1102199025 12:111044731-111044753 CTGAATCCACAGGAGGGATGAGG + Intronic
1104147655 12:126050947-126050969 CTGAATGATGAGAAGGATTCGGG - Intergenic
1104304580 12:127597922-127597944 CTGGATCCTGAGAAGGAATCTGG - Intergenic
1105268183 13:18841772-18841794 CTGAATCAAGTGAAAAAATCAGG - Intergenic
1106182288 13:27380160-27380182 CACAATCATCAGAAGGAATGTGG - Intergenic
1110049635 13:70879288-70879310 CTGACTCACCAGAATGAAACAGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1112883050 13:104133278-104133300 CTGAAGTCACAGAAGAAATCAGG - Intergenic
1113100192 13:106709400-106709422 ATGACACCACAGAAGGAATCTGG + Intergenic
1113385981 13:109848494-109848516 CAAAATCAAAAGAAGAAATCTGG - Intergenic
1114811573 14:25906532-25906554 CTGACTGACCAGAAGGAACCAGG + Intergenic
1118062826 14:62159653-62159675 CTGAATCTACAGTGGGAGTCTGG + Intergenic
1118562672 14:67103301-67103323 CTGAATAAAAAGAAGAAAACTGG - Intronic
1119026308 14:71155648-71155670 CAGAATCAGCTGAAGGCATCAGG + Intergenic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1126821766 15:52511379-52511401 CTGAATCAGGAGAAGTAATGTGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127389604 15:58494773-58494795 CTGAATGCACATAAGGAATCTGG + Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1130443830 15:83980329-83980351 CTCAATCAACAGAATGTGTCTGG - Intronic
1135256628 16:20946562-20946584 TTTCATCCACAGAAGGAATCAGG + Intronic
1138637429 16:58352228-58352250 ATGAATAAACAGAAGCAATGAGG - Intronic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141750770 16:85956428-85956450 ATGAATAAACAGAAGTATTCTGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1149592894 17:57845429-57845451 CTGAAACAACAGTAAGAATAAGG + Intronic
1152044719 17:77928421-77928443 CTGAATGAAGAAAAGGAAGCAGG + Intergenic
1153599088 18:6761517-6761539 CTGAACCCACAGCATGAATCTGG + Intronic
1153848026 18:9067170-9067192 GTGAATCATCAGAAAGAACCAGG - Intergenic
1154419837 18:14218276-14218298 CTGAATCAAGTGAAAAAATCAGG + Intergenic
1155713169 18:28907402-28907424 CTGAGGCAACAGAATGAACCTGG + Intergenic
1159879895 18:73848783-73848805 CTAAGACAACAGAAGAAATCAGG + Intergenic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1163193875 19:15700653-15700675 CTGAGTGAAAAGAAGAAATCTGG + Intergenic
1164340269 19:24387612-24387634 CTGAATCAAAAGAAAGGTTCAGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166355927 19:42227252-42227274 CTGAAGGAAAAGTAGGAATCTGG + Exonic
1168504275 19:56920095-56920117 CAGAATCACCAGGAGGACTCGGG - Intergenic
1202641572 1_KI270706v1_random:95554-95576 CTGAATCAAGTGAAAAAATCAGG - Intergenic
927236829 2:20882412-20882434 CTGCACCAACAGAGGGAATAGGG - Intergenic
928653647 2:33427099-33427121 CTGAGTCATCATAAGGAATCTGG - Intergenic
930931691 2:56892302-56892324 CCCAGTCATCAGAAGGAATCTGG + Intergenic
931838184 2:66121793-66121815 CAGAATCAACACAAGAATTCAGG + Intergenic
934095940 2:88604107-88604129 CTGAAACAACAGCAGAAATTGGG - Intronic
936968428 2:118150348-118150370 CTGAGTCCAGAGAAGAAATCTGG - Intergenic
938598891 2:132817216-132817238 CAGAATCATCTGAAGGAATCAGG + Intronic
938753785 2:134361257-134361279 CTCAATCACCAGGAGGAATTTGG + Intronic
940584733 2:155632654-155632676 CTGAATCAATGGGAGGAACCAGG - Intergenic
943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG + Intergenic
944258935 2:197655122-197655144 CTGAAACAACAGAATGAAAGGGG - Intronic
944968784 2:204967553-204967575 CTGAATCAGCAGGAGAAATTTGG + Intronic
945095929 2:206219258-206219280 CTGAATCAACACATGGCATCGGG - Intergenic
945266717 2:207898101-207898123 CTGAATTACGAGAAGGAATTTGG - Intronic
1169170520 20:3461069-3461091 CTGAATAAACCCAAGAAATCTGG + Intergenic
1170363813 20:15578219-15578241 CTGAATCATCAGAACTCATCAGG - Intronic
1170399772 20:15968995-15969017 CTGATTCTACAGAAGGTGTCTGG + Intronic
1171188238 20:23138765-23138787 CGCAATCAACTGAAGGCATCTGG + Intergenic
1171218764 20:23374280-23374302 CTGCATCAACAGAAGTTACCAGG + Intergenic
1171888693 20:30685751-30685773 CTGAATCAAGTGAAAAAATCAGG - Intergenic
1172001887 20:31785139-31785161 CTCAATCAAAAGTAGGTATCAGG - Intronic
1175782917 20:61695134-61695156 CTGAATCAACATTACCAATCTGG - Intronic
1176853459 21:13941038-13941060 CTGAATCAAGTGAAAAAATCAGG - Intergenic
1178579274 21:33824030-33824052 CTGTATAAACAGAAGTATTCTGG + Intronic
1178728136 21:35073449-35073471 CCCCATCAAAAGAAGGAATCAGG - Intronic
1178807954 21:35854966-35854988 CTTAAACAACAGAATCAATCAGG + Intronic
1180360374 22:11886320-11886342 CTGAATCAAGTGAAAAAATCAGG + Intergenic
1181113444 22:20615904-20615926 CTGAATCAACAGAAGGCCTGTGG + Intergenic
1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG + Intronic
1182890927 22:33818225-33818247 CTGAATCAACTGAAGACAGCAGG - Intronic
1183002621 22:34874371-34874393 CTGAATGAGCAGCAGGATTCAGG + Intergenic
1183149468 22:36026794-36026816 CTAAATCAACAGAAGTAACAGGG + Intronic
1184295230 22:43519295-43519317 ATTAATAAACAAAAGGAATCAGG - Intergenic
1184344318 22:43903662-43903684 TTTAATGAACAGAAGGAGTCCGG - Intergenic
955147242 3:56331965-56331987 GTGAATCTTCAGCAGGAATCAGG - Intronic
955510886 3:59679295-59679317 CTGATTCAATAGAAGCAATAAGG - Intergenic
956017726 3:64901706-64901728 CTGAATCAGCAGGAGCAACCAGG - Intergenic
956558040 3:70543042-70543064 CTGCAGCAACTGAAGGCATCTGG - Intergenic
957535094 3:81492336-81492358 CTGATTCAATAAAAGGAAGCTGG + Intronic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959371918 3:105537566-105537588 ATTACTCTACAGAAGGAATCTGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960364625 3:116756146-116756168 CTGAAACAATAGAAGCCATCTGG - Intronic
961147109 3:124603450-124603472 CTGAATCAACAGGTGGGCTCCGG - Intronic
961639565 3:128356719-128356741 GTGGATACACAGAAGGAATCAGG - Intronic
961719300 3:128882010-128882032 CTGAAAAAGCAAAAGGAATCTGG - Intronic
963285419 3:143430455-143430477 CTGATTCAACAGTAGGGACCAGG - Intronic
963852335 3:150221366-150221388 CTGAACCCACAAAAGAAATCTGG - Intergenic
964506841 3:157408892-157408914 GTGAAGCTACAGAAGGAAGCTGG + Intronic
973385085 4:49506079-49506101 CTGAATCAAGTGAAAAAATCAGG - Intergenic
975757224 4:77582867-77582889 TGAAATCAACAGAAGGAATGTGG + Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
979714574 4:123822212-123822234 CTGAAAGAAAAGAAGAAATCTGG - Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
981236881 4:142427654-142427676 CTGAAGCAGCAGAAGCAATTAGG - Intronic
981660182 4:147157704-147157726 CTGATTGAAGAGAAGAAATCAGG + Intergenic
981975402 4:150722350-150722372 CTGAGTCAAAAGAAAGAATCTGG + Intronic
983977515 4:173953261-173953283 GTGATTCCACAGAAGGAGTCAGG + Intergenic
984938401 4:184909880-184909902 CTGAATGCAAAGAAGGAATGAGG - Intergenic
1202768942 4_GL000008v2_random:181415-181437 CTGAATCAAGTGAAAAAATCAGG - Intergenic
987779031 5:22408482-22408504 CAGGAGCAACAGAAGCAATCTGG + Intronic
989952888 5:50321653-50321675 CTGCATCACCAGAATGAATCGGG + Intergenic
991434232 5:66580124-66580146 ATTAATCAATAGAAGGAAGCAGG - Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994551792 5:101243004-101243026 CTCAATCAACAGAAAGAATCAGG + Intergenic
996019189 5:118573307-118573329 GTGAACCACCAGAAGGAAGCTGG - Intergenic
996700040 5:126441574-126441596 CTAAATAAAGAGAAGGAATATGG - Intronic
997864042 5:137444986-137445008 CTCAATCAACTGTAGGTATCTGG + Intronic
998094643 5:139390387-139390409 CTCAACCACCAGAAGGAATGAGG + Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000343437 5:160294926-160294948 GAGAATCCACAAAAGGAATCTGG - Intronic
1002318041 5:178357112-178357134 CTGAAAGAACAGAAGGGAACAGG - Intronic
1005211074 6:23464394-23464416 GTGAATCAATAAAAGGAACCAGG + Intergenic
1008826383 6:55699388-55699410 CTGAATCTATAGAAGGACTGAGG + Intergenic
1009254349 6:61363400-61363422 CTGTATCAAAAGAAAGATTCAGG - Intergenic
1010358081 6:74958827-74958849 CTGGATCATTAAAAGGAATCTGG - Intergenic
1011796106 6:90954300-90954322 CTGAATCAATAGAAGAATTAGGG - Intergenic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1015262675 6:131256383-131256405 ATGAATTAATAGATGGAATCAGG - Intronic
1016473503 6:144400693-144400715 CTGTATCAAGAGAATGAATGCGG + Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1018540348 6:164872996-164873018 CTGCATCAACAGAAGGCCTGTGG - Intergenic
1023032786 7:36105370-36105392 CTGGAGCAACAGAAATAATCTGG + Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023291652 7:38674381-38674403 AAGAAACAACAGAAGGAATCTGG - Intergenic
1023672725 7:42595471-42595493 TTAATTAAACAGAAGGAATCAGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024463817 7:49687095-49687117 CTGAATTAACAGAAGATAGCTGG - Intergenic
1025852536 7:65256566-65256588 ATGAAGCAGAAGAAGGAATCAGG + Intergenic
1026156065 7:67826887-67826909 CTCACTCAAAGGAAGGAATCAGG + Intergenic
1026778847 7:73249863-73249885 GTGAGTCAAGAGAAGGAATCTGG - Intergenic
1027019707 7:74803271-74803293 GTGAGTCAAGAGAAGGAATCTGG - Intronic
1027068319 7:75142670-75142692 GTGAGTCAAGAGAAGGAATCTGG + Intronic
1029340370 7:99938834-99938856 CTGAATCAGCAGAAGCTATTTGG - Intergenic
1030294866 7:107913236-107913258 CTGAATAAAAAGAAGAAAGCTGG - Intronic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1030903574 7:115154168-115154190 CTGAGTCACCAAAAGTAATCAGG - Intergenic
1031102886 7:117504313-117504335 CAGAATCAACAGAAGGGATTTGG - Exonic
1031135294 7:117877447-117877469 CTGAATAAACAGAAATATTCAGG - Intergenic
1033225337 7:139557977-139557999 CTCAAGAAACAAAAGGAATCTGG - Intergenic
1034199216 7:149271850-149271872 CTGAATCCACAGAAGAACTGAGG - Intronic
1039254801 8:35707240-35707262 CTGAAGCAACATAAGGAAATAGG - Intronic
1039652421 8:39356608-39356630 CAGAATCAACAAAAGTATTCTGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1047859681 8:128951629-128951651 GTTAATCAGAAGAAGGAATCTGG + Intergenic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048843075 8:138581881-138581903 TTGATCCCACAGAAGGAATCAGG - Intergenic
1049856446 8:144864975-144864997 CAGAATTAACAGAAGGTAACAGG + Intergenic
1050061706 9:1716317-1716339 CTGAAAGAACAGAAGCAATTAGG + Intergenic
1050651805 9:7784896-7784918 CTCAATGACCAGAAGAAATCTGG - Intergenic
1050883432 9:10734098-10734120 GTGATACAACAGAAGAAATCAGG + Intergenic
1051613383 9:18982972-18982994 CTAAATCAGCAGAGGAAATCAGG + Intronic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053667073 9:40324050-40324072 CTTAATGACCAGAAGAAATCTGG + Intronic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054360755 9:64114211-64114233 CTGAATCAAGTGAAAAAATCAGG + Intergenic
1054378220 9:64464078-64464100 CTTAATGACCAGAAGAAATCTGG + Intergenic
1054517537 9:66052233-66052255 CTTAATGACCAGAAGAAATCTGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1057863593 9:98661898-98661920 CTGAATCAAGGCAAGGGATCAGG - Intronic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1059834483 9:118135773-118135795 CTGAATCAAAAACAGGAGTCTGG - Intergenic
1203693832 Un_GL000214v1:75153-75175 CTGAATCAAGTGAAAAAATCAGG - Intergenic
1203558285 Un_KI270744v1:23533-23555 CTGAATCAAGTGAAAAAATCAGG - Intergenic
1203642441 Un_KI270751v1:28910-28932 CTGAATCAAGTGAAAAAATCAGG + Intergenic
1185771243 X:2767129-2767151 CTGAATCAACATAAAGAATTTGG + Intronic
1188636414 X:32437217-32437239 CCAAATCAACATAAGGAATTGGG - Intronic
1189018999 X:37315152-37315174 CTGAAACAAAAGAAAGATTCAGG + Intergenic
1189554366 X:42126788-42126810 CTGTAGCATCAGAAGGATTCTGG + Intergenic
1189560921 X:42190832-42190854 GTGAATTAACAGAATGAATAGGG - Intergenic
1190763848 X:53459724-53459746 CTGGATGAACAGAGAGAATCTGG + Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1195859414 X:109365691-109365713 CTGAATCAAATGATGGAAGCTGG - Intergenic
1195971021 X:110473600-110473622 CTGAATCAAGAGGAGGGATTAGG - Intergenic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1197312331 X:124920097-124920119 CTGAATCAACAAAAAAAATACGG + Intronic
1197708674 X:129651330-129651352 CAGAATCAAAAGTAGGAAACAGG - Intronic
1200877090 Y:8168563-8168585 CTGTATGAACAAAGGGAATCAGG + Intergenic
1201147286 Y:11072259-11072281 TTAAATGAACAGAAGGAAGCCGG - Intergenic
1201496324 Y:14594223-14594245 ATGATCCAACAGAAGGAATGAGG - Intronic