ID: 1146374848

View in Genome Browser
Species Human (GRCh38)
Location 17:32287170-32287192
Sequence CACATGCCCAGTGCTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 7, 3: 68, 4: 453}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146374848_1146374853 -9 Left 1146374848 17:32287170-32287192 CCCAGCACAGCACTGGGCATGTG 0: 1
1: 0
2: 7
3: 68
4: 453
Right 1146374853 17:32287184-32287206 GGGCATGTGAGGGACGCAGGTGG 0: 1
1: 1
2: 2
3: 38
4: 386
1146374848_1146374854 -5 Left 1146374848 17:32287170-32287192 CCCAGCACAGCACTGGGCATGTG 0: 1
1: 0
2: 7
3: 68
4: 453
Right 1146374854 17:32287188-32287210 ATGTGAGGGACGCAGGTGGATGG 0: 1
1: 0
2: 0
3: 27
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146374848 Original CRISPR CACATGCCCAGTGCTGTGCT GGG (reversed) Intronic
900395031 1:2449981-2450003 CACTTCCCCAGGGCTGAGCTTGG - Intronic
900482998 1:2908387-2908409 CACTTGCCCTGTGCTGTTCCTGG + Intergenic
900534317 1:3169486-3169508 CACATGCCCCAGGCTGTGCACGG - Intronic
900800367 1:4733465-4733487 CGTGTGCCCAGGGCTGTGCTGGG + Intronic
900921936 1:5678268-5678290 CACATGCCCATTTCTTGGCTGGG + Intergenic
902513345 1:16977721-16977743 CACGTGCCAAGTGCTGGGCTAGG - Intronic
902531462 1:17093495-17093517 TTCATGCCCAGTCCTGGGCTGGG - Intronic
902660189 1:17895638-17895660 CACATGCCCACTCCTGTGGTGGG + Intergenic
903185403 1:21626230-21626252 CACATGCCCAGGGCTGGGAAAGG - Intronic
903307338 1:22422465-22422487 CACATGCCAAGCACTGTGTTAGG + Intergenic
903605592 1:24572991-24573013 CCCATGCCCAGTGGTGGGCATGG + Intronic
903832097 1:26181648-26181670 CACATGCCAAGCCCTGTTCTAGG - Intronic
904089563 1:27935241-27935263 GACATTCCCAGTGCTGTACCTGG - Exonic
904877390 1:33666748-33666770 CACATACTCACTGCTGTGCCAGG + Intronic
904992444 1:34604019-34604041 AACATGTCCAATGCCGTGCTAGG + Intergenic
905174720 1:36128140-36128162 CCCCTGCCCAGTGCTTTGCAGGG + Intergenic
905728257 1:40274103-40274125 CAGATTACCAGTGCTGGGCTTGG + Intronic
906034015 1:42739878-42739900 CACTTGCCCAGTGCTCTGGGAGG + Exonic
906157471 1:43622174-43622196 CACTTGCCCAGGGATGTTCTAGG - Exonic
906963766 1:50436480-50436502 AATGTGCCCAGTACTGTGCTTGG - Intergenic
907113213 1:51946165-51946187 CATGTGGCCAGTGCTCTGCTAGG - Intronic
907227616 1:52963330-52963352 AACATGCCAAGCTCTGTGCTTGG - Intronic
907637349 1:56149265-56149287 TACATGCCAGGTGCTGTGATGGG + Intergenic
907786479 1:57617859-57617881 CAAGTGCCCAATTCTGTGCTAGG - Intronic
907953602 1:59207111-59207133 CACAACTCAAGTGCTGTGCTGGG - Intergenic
907998630 1:59658114-59658136 CTAATGTCCAGTGCTGTGCCTGG - Intronic
908203404 1:61820753-61820775 CTCATCCCCAGTGCGGTGCTGGG - Intronic
912510411 1:110185844-110185866 CAGATGCCCAGTGCTAATCTGGG - Intronic
912711866 1:111955791-111955813 TACATGACCAGCACTGTGCTAGG + Intronic
912898476 1:113620623-113620645 TATATCCCCAGTGCTTTGCTAGG + Intronic
913502160 1:119481305-119481327 CCCATGCCCAGTGAGGTGCCAGG - Intergenic
913533281 1:119748218-119748240 CACATGCCAAGTGCTATGACAGG - Exonic
915083383 1:153367305-153367327 CATGTGCCCAGTGCTGTGTTAGG + Intergenic
916204489 1:162301951-162301973 CTCATGCCAGGTACTGTGCTAGG + Intronic
918171335 1:182000431-182000453 CTCCTGCTCAGTGATGTGCTGGG - Intergenic
918479019 1:184957186-184957208 AGCAACCCCAGTGCTGTGCTAGG - Intronic
918524208 1:185447286-185447308 CACATGCAAAGGGCTGTCCTGGG + Intergenic
918589090 1:186221076-186221098 CACATGCCCACTGCTTTGCGTGG - Intergenic
920184788 1:204152744-204152766 CCCGAGCCCAGTGCTTTGCTTGG + Intergenic
920353826 1:205355889-205355911 TACATACACATTGCTGTGCTTGG - Intronic
920435976 1:205947480-205947502 CATGTGCCCAGCACTGTGCTAGG + Intergenic
920854621 1:209652568-209652590 CACTTGCCCAGTCCCGTCCTGGG - Intergenic
920854908 1:209654301-209654323 GACATGCCAATTGCTGTGCTTGG + Intergenic
921621165 1:217327995-217328017 TATGTGCCAAGTGCTGTGCTAGG + Intergenic
921758624 1:218886669-218886691 CACAGGCCAAGAGCTGTTCTCGG - Intergenic
922359627 1:224809640-224809662 CAGATACCCACAGCTGTGCTTGG + Intergenic
923311674 1:232741617-232741639 AAAATGCCCAGTACAGTGCTTGG + Intergenic
923459762 1:234198130-234198152 CACCTGTTCACTGCTGTGCTAGG - Intronic
1063263859 10:4423117-4423139 CAAATGCCCACTGCTATGCCTGG - Intergenic
1063462161 10:6221783-6221805 CACATGACCACTGCTGTGCAGGG + Intronic
1064033789 10:11899654-11899676 CACATGCCCTGTGCTCATCTGGG + Intergenic
1065158301 10:22893647-22893669 CAGAGGCACAGTGCAGTGCTGGG - Intergenic
1065373013 10:25009595-25009617 CACATGGCAAGTACTTTGCTAGG - Intronic
1066413153 10:35193178-35193200 CACATGCCAGGGTCTGTGCTAGG - Intronic
1066596570 10:37057472-37057494 CACGTGCCAGGTGCTGAGCTAGG - Intergenic
1067041415 10:42955159-42955181 CAAAGGACCAGTGCTGAGCTGGG + Intergenic
1067279474 10:44860492-44860514 CACATACTCAGTGCTGTACTAGG + Intergenic
1069626917 10:69873873-69873895 CACCTGCCCACAGCTGTGCTAGG + Intronic
1069915732 10:71785547-71785569 CAGATGCCAACTGCTCTGCTTGG - Intronic
1070212287 10:74337370-74337392 CACCTGCCTGGTGCTGTGGTGGG + Intronic
1070765450 10:79053637-79053659 CACATGCCCAGAGAGGTGATGGG - Intergenic
1072108417 10:92295115-92295137 CATATGCCCAGTACTATTCTAGG + Intronic
1072756304 10:98023434-98023456 CACATGCCAAGTGCCATGCTAGG + Intronic
1073043760 10:100624146-100624168 AGCATGCCAGGTGCTGTGCTAGG + Intergenic
1073442818 10:103562828-103562850 CCCAGGCCCATTTCTGTGCTGGG - Intronic
1073719108 10:106145377-106145399 TATATGCTCAGTACTGTGCTAGG + Intergenic
1074045776 10:109837852-109837874 CACATGCCAAGTATTGTGCTAGG + Intergenic
1074080969 10:110167914-110167936 CACAGGCCAAGTGCTGTTCTAGG - Intergenic
1074087209 10:110217419-110217441 GACATGCCCAGGGCTGCTCTGGG + Intronic
1074738795 10:116464519-116464541 GGCATGCCCACTGCTGTGGTAGG + Intronic
1075294922 10:121266617-121266639 TATCTGCCAAGTGCTGTGCTAGG - Intergenic
1075318088 10:121468147-121468169 CCCATCTCCAGTGCAGTGCTGGG + Intergenic
1075636447 10:124034147-124034169 CACAGGCTGGGTGCTGTGCTGGG - Intronic
1075895923 10:125994345-125994367 TACATGCCAAGTCCTGTGCTAGG - Intronic
1076171531 10:128324012-128324034 CACATGCCTAGTGCTGAGCTGGG - Intergenic
1078352676 11:10607586-10607608 CACAGGCCCTTTCCTGTGCTGGG + Intronic
1078963728 11:16311957-16311979 CACATGCTCATTCTTGTGCTGGG + Intronic
1079323123 11:19469049-19469071 CACATGCCAGGTACTATGCTAGG - Intronic
1080266628 11:30408182-30408204 CTTATCCCCTGTGCTGTGCTGGG + Intronic
1080596373 11:33777256-33777278 CACATCCCCAGGGCTAAGCTTGG + Intergenic
1081527422 11:43936421-43936443 AACATGCCGGGTACTGTGCTAGG + Intronic
1082896127 11:58191713-58191735 CACATGCTAGGTGCTTTGCTAGG - Intergenic
1083593397 11:63908005-63908027 CACATTCCCAGATCTGTGCCGGG - Intronic
1083675288 11:64321731-64321753 CACCTGCCCAGCCCTGTGCTGGG + Exonic
1083730219 11:64648750-64648772 CACCTGCCCAATGCGGTGCAGGG + Exonic
1084480888 11:69419409-69419431 CCCATGCCCGGAGCTGTGCCTGG - Intergenic
1084936040 11:72587197-72587219 CCCATGCCCAGTGCAGAGCCTGG + Intronic
1085061043 11:73447408-73447430 CAGATGCGCACTGCTGTGCCTGG - Intronic
1085303624 11:75473040-75473062 CAAAGGCCCAGTGCTGTGAAGGG + Intronic
1085603023 11:77872415-77872437 CTCATGCCAGGTCCTGTGCTAGG + Intronic
1085829593 11:79885241-79885263 TACATGCCTAGGTCTGTGCTAGG - Intergenic
1085845059 11:80055829-80055851 TATATGCCCAGTTCTGTGCTAGG + Intergenic
1085883059 11:80490546-80490568 TACATGCCCAGCACTCTGCTAGG - Intergenic
1086156589 11:83673195-83673217 CACATGCTCATTGTTGTGCAGGG + Intronic
1086156864 11:83676896-83676918 CACGTGCCAAGTGCTCTGCTGGG - Intronic
1086475684 11:87170803-87170825 CAGAGCTCCAGTGCTGTGCTGGG + Intronic
1086865707 11:91977433-91977455 CACATAAACAATGCTGTGCTAGG - Intergenic
1086903541 11:92394052-92394074 TACATGTCCAGTGCTGTGGTGGG - Intronic
1088500171 11:110474935-110474957 CATATGTCCAGCACTGTGCTAGG + Intergenic
1088592187 11:111413450-111413472 CACACACCCAGTGCTGTGATAGG + Intronic
1088815238 11:113416350-113416372 CACATGCCCATTTCTGTGGGAGG - Intronic
1088901021 11:114117374-114117396 TCCATCCCCAATGCTGTGCTCGG - Intronic
1089012219 11:115140545-115140567 CATGTGCCCCGTTCTGTGCTAGG - Intergenic
1089115658 11:116093182-116093204 CACCTGGCCTCTGCTGTGCTGGG + Intergenic
1089285415 11:117404666-117404688 CAGAGCCCAAGTGCTGTGCTGGG + Intronic
1089401381 11:118166525-118166547 CACCTGCCCAGTGCTTGGCCTGG - Exonic
1089870355 11:121667148-121667170 CACATGTCCAGTACTATGCTAGG + Intergenic
1090354652 11:126132018-126132040 CATATGCCAAATGCTGAGCTAGG - Intergenic
1090578492 11:128134009-128134031 TATGTGCCCAGTGCTGTGCCAGG - Intergenic
1090711257 11:129387836-129387858 CACGTGCCCGGCACTGTGCTAGG + Intronic
1091995908 12:4993938-4993960 TACATGCCAAGTGCTCTGCTGGG + Intergenic
1092156411 12:6284559-6284581 GACATGTCCAGAGCTGTGCTGGG - Intergenic
1092290959 12:7159205-7159227 CAGATGCCCAGTGCCTTGCAGGG + Intergenic
1092455497 12:8639076-8639098 CAAGTGCCCAGGGCAGTGCTGGG - Intronic
1092525219 12:9305687-9305709 CACATGCCTACAGCTGGGCTTGG + Intergenic
1092542052 12:9426130-9426152 CACATGCCTACAGCTGGGCTTGG - Intergenic
1093223762 12:16455457-16455479 TACCTGCCAAGTGCTGTGCTAGG - Intronic
1093850316 12:24028286-24028308 GACAGGCACTGTGCTGTGCTGGG - Intergenic
1096412483 12:51387485-51387507 CACATGCCAAGCGCTGCTCTAGG - Intronic
1096461498 12:51823789-51823811 CACATTCCAAGTGTTTTGCTAGG + Intergenic
1097275403 12:57810095-57810117 CACATGCCCAGGGATGTGGAAGG - Intronic
1097857701 12:64483476-64483498 CACATAACAAGTGCTGTTCTTGG + Intronic
1097867681 12:64572612-64572634 CATATGCCGAGCTCTGTGCTTGG - Intergenic
1099063871 12:77949251-77949273 TATATACCTAGTGCTGTGCTAGG + Intronic
1099320257 12:81138286-81138308 GACATGCCAAGCACTGTGCTAGG + Intronic
1101422250 12:104559266-104559288 TACATGCCAAGTACTGTGCTAGG - Intronic
1101826683 12:108225765-108225787 TATGTGCCCAGTTCTGTGCTGGG - Intronic
1102464373 12:113119943-113119965 CACCTGCCAGGTGCTATGCTTGG - Intronic
1102484089 12:113244369-113244391 CATTTGCCCAGGGCTCTGCTTGG + Intronic
1102623805 12:114218409-114218431 CACATGCCCAGGCCTCTCCTTGG - Intergenic
1102733322 12:115134548-115134570 CTCATGACCAGTGCTGTGGGTGG + Intergenic
1102907446 12:116687777-116687799 TACATGCCTAGCACTGTGCTGGG + Intergenic
1102957693 12:117070107-117070129 AACAGGCCCTGGGCTGTGCTGGG - Intronic
1103209649 12:119157004-119157026 CATATGCCCAGGCCTGAGCTGGG - Exonic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104116926 12:125758752-125758774 CACATGGCCAGTACTGGGCTCGG - Intergenic
1104131748 12:125900369-125900391 CACCTGCCCAGGGCTGAGTTTGG + Intergenic
1104144705 12:126021670-126021692 TAAGTGCCCAGTACTGTGCTGGG - Intergenic
1104687803 12:130800209-130800231 CACATGCTCTGTGATGTGCATGG - Intronic
1105427197 13:20304102-20304124 CACATGCCAGGTACTGTGCTAGG + Intergenic
1106037075 13:26052472-26052494 CACACGCCTAGGGCTGTGTTTGG + Intergenic
1106087405 13:26556023-26556045 CACATGCTCAGCACTGTACTAGG + Intergenic
1106612244 13:31295328-31295350 CAGAGCTCCAGTGCTGTGCTGGG + Intronic
1106789623 13:33141493-33141515 CACATGGCAAGTCCTGTGATGGG + Intronic
1107699184 13:43030791-43030813 AACCTACCCCGTGCTGTGCTTGG - Intronic
1107714823 13:43189689-43189711 CACATGCCAAGCTCTGTTCTAGG - Intergenic
1108098247 13:46927663-46927685 CACATGACCAGTCCTGTGTTTGG - Intergenic
1109902751 13:68795390-68795412 CAGAGGTCTAGTGCTGTGCTGGG + Intergenic
1110020004 13:70457932-70457954 CAGAGGTCAAGTGCTGTGCTGGG - Intergenic
1110742902 13:79018626-79018648 CAAGTGCCCAGAGCTGTCCTTGG + Intergenic
1112920973 13:104612579-104612601 CAGAACCCCAGTCCTGTGCTTGG + Intergenic
1113696468 13:112349618-112349640 CACAAGCCCACAGCTCTGCTGGG + Intergenic
1113750334 13:112772656-112772678 CAGCTGCCCAGGGCTGGGCTGGG - Intronic
1114614357 14:24060360-24060382 CACATGCTCAGTCCAGTGATAGG - Intronic
1116509853 14:45731360-45731382 TACATGCCCGGTGTTGCGCTGGG + Intergenic
1117227444 14:53677320-53677342 CTCATTCCCAGTGTTCTGCTAGG + Intergenic
1117521279 14:56553605-56553627 CTCATTCCTAGTGCTATGCTAGG + Intronic
1118829103 14:69412607-69412629 CAAGTCCCCAGTGCTTTGCTTGG + Intronic
1119203997 14:72780433-72780455 TACATTCCCAGTACTGTGCATGG - Intronic
1119684994 14:76624371-76624393 CACCAGCCCAGAGCTGGGCTGGG - Intergenic
1119821362 14:77618859-77618881 CATATGCAAAGTTCTGTGCTAGG + Intergenic
1120894349 14:89516513-89516535 CACATGCAAAGTTCCGTGCTAGG + Intronic
1122016881 14:98803825-98803847 CACTTGCCAGGTGCTGGGCTGGG - Intergenic
1122022306 14:98848333-98848355 TGAATGCCCAGTGCTGTTCTGGG + Intergenic
1122088521 14:99322945-99322967 GACATACCCAGTGCTCTGCCTGG + Intergenic
1122986850 14:105216425-105216447 CGCATGCCAGGAGCTGTGCTAGG + Intronic
1123000472 14:105291302-105291324 GAAATGGACAGTGCTGTGCTGGG - Intronic
1123888244 15:24748942-24748964 GAGATGCCCAGTCCTGTGCCTGG - Intergenic
1124348021 15:28935283-28935305 CCCATGCGAAGTGCTGTGCATGG - Intronic
1124383469 15:29186981-29187003 CACATACCTAGAGCTGTGTTTGG + Intronic
1124864623 15:33477103-33477125 CTCATGCCCAGTGCCAAGCTTGG - Intronic
1125540394 15:40466607-40466629 AACAAGCTCAGAGCTGTGCTGGG - Exonic
1125743573 15:41984189-41984211 CATGTGCCCAGTACTGTGCTTGG - Intronic
1125767424 15:42144969-42144991 CTCATGCCTAGTGCAGTGCTGGG - Intronic
1127513980 15:59673685-59673707 CTCATGCCCAGTGCTTTGGGAGG - Intronic
1128421016 15:67491718-67491740 CACATGCCCAGAGGTGTCCCTGG - Intronic
1128476295 15:67999776-67999798 TGCATGCCCAGTCCTGTGTTTGG + Intergenic
1128789560 15:70423143-70423165 CTCATGCCCAGAGCTGGGTTTGG - Intergenic
1128870286 15:71149963-71149985 CATCTACCCAGTGCTGTTCTAGG - Intronic
1129300175 15:74620909-74620931 CACATGCCCAGAGCAGGGCCTGG + Intronic
1129521143 15:76186969-76186991 TACCAGCCCAGGGCTGTGCTTGG + Intronic
1129711243 15:77821144-77821166 CATATGCCCCATCCTGTGCTAGG + Intergenic
1129866914 15:78915835-78915857 CACATGCCCAGCCCTGCCCTAGG - Intergenic
1131076832 15:89500606-89500628 CACATGCCAGGCACTGTGCTGGG - Intergenic
1131079723 15:89524578-89524600 CACAGGCCCACTGCTATGCTGGG + Intergenic
1131222241 15:90594652-90594674 CCCATGCCAGGCGCTGTGCTGGG + Intronic
1131560300 15:93433945-93433967 CCGGTGCCCAGTGCTGTGTTTGG + Intergenic
1132389550 15:101428315-101428337 CACATGGCCACTGCTGTGTAGGG + Intronic
1132933863 16:2471510-2471532 AACATCCCCGCTGCTGTGCTGGG + Exonic
1133237798 16:4395742-4395764 CACATGCTCAGCCCTGTACTAGG + Intronic
1133287993 16:4699431-4699453 CACATGCTCAGTTCTGTGAAGGG + Intronic
1133752993 16:8739110-8739132 TGCATGCCAAGTGCTGTGCTGGG + Intronic
1134311491 16:13079144-13079166 TACGTGCCAAGGGCTGTGCTCGG - Intronic
1134319828 16:13152650-13152672 CACATGTCCAGTCATGTGCCAGG + Intronic
1135133864 16:19873531-19873553 CACAGGCCAAGTGCTGCACTGGG + Intronic
1135267328 16:21038710-21038732 CTTATGCCCAGCCCTGTGCTGGG - Intronic
1135508047 16:23056120-23056142 CCCATGCCCAGGCCAGTGCTTGG + Intergenic
1135563720 16:23495942-23495964 CATGTGCCCAATGCTGTGCTGGG - Intronic
1137015162 16:35367033-35367055 CACAATCTCAGTGTTGTGCTGGG + Intergenic
1137621650 16:49880311-49880333 CATCTGGCCAGTGCTGGGCTGGG - Intergenic
1137690253 16:50421391-50421413 CACATGGCCAATGCTGAGATGGG + Intergenic
1137765045 16:50971589-50971611 CACATGCCAAGTCCTGTGCCAGG + Intergenic
1137973273 16:53006840-53006862 TATATGCCAAGTTCTGTGCTAGG + Intergenic
1139440288 16:66963333-66963355 CACCCTCCCAGGGCTGTGCTGGG - Exonic
1139682610 16:68576808-68576830 CACATGCATAGCGCTGTGCAAGG + Intergenic
1139956200 16:70694157-70694179 CTCAAGCCCAGGGCTTTGCTGGG - Intronic
1140732584 16:77870152-77870174 CACGTGCTGGGTGCTGTGCTTGG + Intronic
1144811783 17:18005095-18005117 CACCTGCCCTGTGATGTGATGGG - Intronic
1145897153 17:28465816-28465838 CATGTGCCCAGTGCTCTTCTTGG - Intronic
1146374848 17:32287170-32287192 CACATGCCCAGTGCTGTGCTGGG - Intronic
1146499622 17:33353262-33353284 AACATGCCCATTGCCGTGGTGGG + Intronic
1146821771 17:35988834-35988856 CATATGCCAAGTCCTGGGCTAGG + Intronic
1148051200 17:44770643-44770665 CACAGGCCCAGGGGTGTCCTGGG + Intronic
1148122148 17:45219641-45219663 TACATGCCCATCACTGTGCTTGG - Intergenic
1148467980 17:47876278-47876300 CCCATCCCCACTGCTGAGCTCGG - Intergenic
1148959094 17:51378245-51378267 CACTTGCCAAGCACTGTGCTGGG - Intergenic
1150502371 17:65663618-65663640 CAGATGTCTAGTTCTGTGCTGGG - Intronic
1151719009 17:75845157-75845179 CCTGTGCCCAGTGCTGGGCTGGG + Intergenic
1151961485 17:77408128-77408150 GACATGCCCAGAACTGAGCTGGG - Intronic
1152110895 17:78357367-78357389 GACATTCCCAGTGCTCAGCTGGG + Exonic
1152339840 17:79718110-79718132 AACAAGCCCTGTGCTCTGCTGGG - Intergenic
1152460915 17:80441880-80441902 CAAGTGCCCAGTGCAGAGCTAGG + Intergenic
1153015216 18:576987-577009 CACATGCATAGTGCCCTGCTTGG + Intergenic
1153017361 18:596312-596334 CCCATGCCAGGTGCTGTCCTTGG - Intergenic
1153243413 18:3051345-3051367 GTCCTGCCCAGTGCTGTGCATGG + Intergenic
1154410219 18:14136230-14136252 AAGATGCCCAGTGAAGTGCTAGG - Intergenic
1154505561 18:15037288-15037310 CCCAAACCCTGTGCTGTGCTGGG + Intergenic
1157171879 18:45414712-45414734 CACATGCCAGGTGCGGTGCAAGG + Intronic
1157318924 18:46619535-46619557 TACATGCCCAGCACTGTGCTAGG - Intronic
1157407193 18:47431919-47431941 CAGGTGCTCAGTCCTGTGCTAGG - Intergenic
1157828190 18:50831444-50831466 CATGTGCCAAGTACTGTGCTGGG - Intergenic
1158319910 18:56251254-56251276 CAAACACCAAGTGCTGTGCTAGG + Intergenic
1158877798 18:61749754-61749776 CACATGCTCAGGGTTGTGCAGGG - Intergenic
1160048989 18:75414339-75414361 TACATGCCAAGTACTGTGCTAGG + Intronic
1160515855 18:79478838-79478860 CCCATGCCTGGTGCTGTTCTGGG - Intronic
1160590487 18:79941849-79941871 AAGATGCCCAGTGCGTTGCTGGG - Intronic
1160590496 18:79941909-79941931 AAGATGCCCAGTGCGTTGCTGGG - Intronic
1161086542 19:2338141-2338163 GACATGCCGACTGCTGGGCTGGG + Intronic
1161632460 19:5365126-5365148 AAAATGCCCAGTGCTGGGTTCGG + Intergenic
1161948233 19:7452229-7452251 CACATGACCAGGGCTGAGCAAGG + Intronic
1162400789 19:10445376-10445398 TCCATCCCCACTGCTGTGCTGGG - Intronic
1162578126 19:11511177-11511199 CACATGACAAGTGCTGTGAGGGG + Intronic
1163556712 19:17997422-17997444 GACATGCCCAGAGCTGCCCTGGG - Intronic
1164436637 19:28236244-28236266 CCCCTGCCCAGTCCTGTGCTAGG + Intergenic
1164755765 19:30688154-30688176 CTCCTGCCCAGGGCTGTGCAGGG + Intronic
1164760944 19:30727852-30727874 CACAAGCCCAGTGGTGTCCTGGG - Intergenic
1165068229 19:33241164-33241186 CACATGCCCACTCCTGGGCCTGG + Intergenic
1166698061 19:44865505-44865527 GTCTTGCCCAGTGCTCTGCTTGG - Exonic
1166726732 19:45033012-45033034 CACATGCCCGGGCCTGTGCTCGG + Intronic
1167023989 19:46901074-46901096 CACATGCCTAGTACAGTGCCTGG + Intergenic
1168280501 19:55302931-55302953 CACATGCAGAGTGCTGGGCGAGG + Intronic
925027639 2:621862-621884 CACGTGGCCAGAGCTCTGCTAGG + Intergenic
925082760 2:1082679-1082701 CACATGCCCAGTGCCTTGTCGGG - Intronic
925234310 2:2264674-2264696 AGCATGCACTGTGCTGTGCTGGG - Intronic
925875225 2:8305719-8305741 CAAATACCCAGTGCTGTTCTTGG - Intergenic
926203314 2:10816876-10816898 CACATGCCCAGTGTGGGTCTTGG - Intronic
926722529 2:15971753-15971775 CCCATGCCCAGTGCAGTGGTTGG - Intergenic
926890871 2:17637812-17637834 CAGGAGCCCAGTGCTGTGCAAGG - Intronic
927044786 2:19266134-19266156 CACATGCTCAGTTCTCTGCTAGG + Intergenic
927242980 2:20934890-20934912 CACCTACCCAGAGCTGGGCTTGG + Intergenic
927351503 2:22122767-22122789 CACATGCACAGTGGCCTGCTTGG - Intergenic
927491490 2:23524171-23524193 GACTTGCTCAGTGCTGTGCTAGG + Exonic
927496262 2:23553796-23553818 CGGATGCCCAGCCCTGTGCTCGG + Intronic
927638069 2:24830442-24830464 CATGTGCCCAGGCCTGTGCTAGG - Intronic
928193746 2:29197541-29197563 CACAGGCCCAGGGCAGTTCTTGG + Exonic
928399260 2:30966114-30966136 CAGGTGCCCAGCGCTGTACTAGG - Intronic
928401907 2:30985079-30985101 CATATGCCAAGTCCTGTGTTAGG - Intronic
928830605 2:35478214-35478236 CAGAGCTCCAGTGCTGTGCTGGG - Intergenic
930101549 2:47607420-47607442 CACATGCCCAGCTCTGTGTCAGG - Intergenic
930235044 2:48880759-48880781 CACATGGCTGGTGCTGTTCTTGG + Intergenic
930956081 2:57204547-57204569 CACATGCCCTGTGGAGAGCTAGG + Intergenic
930977884 2:57486766-57486788 CTAATGCCCAGCGTTGTGCTTGG + Intergenic
932308274 2:70719286-70719308 CACATCCCCAGTGGTGAGCCAGG - Intronic
932311196 2:70743242-70743264 CACATGCACAGTACTGTGTGGGG - Intronic
932416677 2:71577795-71577817 CTTAGCCCCAGTGCTGTGCTGGG - Intronic
932429883 2:71667871-71667893 CAGATGCCCGGCCCTGTGCTGGG + Intronic
932608174 2:73177938-73177960 CACAGGCCTAGCTCTGTGCTGGG + Intergenic
932900138 2:75688258-75688280 CACATGGCAAGTACTCTGCTTGG + Intronic
933721850 2:85402001-85402023 GGCCTGCCCAGGGCTGTGCTTGG - Intronic
935199514 2:100844200-100844222 ACCATGCCCAGCTCTGTGCTGGG + Intronic
937071808 2:119069572-119069594 CACATGTCCAGTTCTGCTCTAGG + Intergenic
937150619 2:119683296-119683318 CCCGTGCCCAGTGCCGTCCTAGG - Intronic
937530719 2:122824128-122824150 AACATGCACAGTGGTGTCCTGGG + Intergenic
938504750 2:131867552-131867574 CCCAAACCCTGTGCTGTGCTGGG + Intergenic
938812550 2:134867043-134867065 CAGAGGCTCAGTGCTGGGCTGGG - Intronic
939028414 2:137041871-137041893 AACATACCTTGTGCTGTGCTGGG - Intronic
940798511 2:158105917-158105939 TTCATGCTCAGTGCTATGCTTGG + Intronic
941733587 2:168947371-168947393 TACATCCCAAGTGCTGTGCTTGG + Intronic
944324725 2:198390811-198390833 CACAAGGCCAGTTCTGTCCTTGG + Intronic
946749363 2:222878130-222878152 CTCATGTCCATTACTGTGCTAGG - Intronic
948398007 2:237661721-237661743 CACATTCTCTGTGCTGTGCATGG + Intronic
948480563 2:238247658-238247680 CACATGCCCAGCCCTTTGCTTGG - Intronic
948929422 2:241122598-241122620 CACATGCCAGGTTGTGTGCTTGG + Intronic
1169870240 20:10241412-10241434 TACATGCCTAGTGCTGCTCTGGG + Intronic
1170876683 20:20256076-20256098 CACATGCCCAGTGCCTTGCAAGG - Intronic
1171289632 20:23974788-23974810 CACATGCCATGAGCTCTGCTGGG + Intergenic
1171975351 20:31591122-31591144 CAAGTTCCCAGTGCTGTGATGGG - Intergenic
1172028400 20:31965347-31965369 CTTGTGCCCAGTGCTATGCTGGG - Intergenic
1172180970 20:33003244-33003266 CCCATTCCCTGTGCTGTGATTGG + Intronic
1172599508 20:36174079-36174101 TACATGCCAAGCACTGTGCTGGG + Intronic
1172684969 20:36746464-36746486 CACGTGCCGAGCACTGTGCTAGG - Intergenic
1172739241 20:37152540-37152562 CACATGGCCGATTCTGTGCTAGG + Intronic
1172744078 20:37193247-37193269 CACATGCCAGGTGCTGTTCTAGG - Intronic
1173162005 20:40659821-40659843 CACATGCCTGGTACTGTTCTAGG + Intergenic
1173289217 20:41699882-41699904 CACGTGCCAGGTTCTGTGCTAGG - Intergenic
1173827015 20:46054667-46054689 CATATGCCTGGTCCTGTGCTGGG + Intronic
1173829887 20:46075893-46075915 CTCATGCAGAGTTCTGTGCTTGG + Intronic
1173848870 20:46205318-46205340 CACATACCAAGTTCTGTGCCTGG - Intronic
1174058551 20:47816390-47816412 CACATGCCAGGTACTCTGCTAGG - Intergenic
1174703099 20:52629144-52629166 TACTTGCCAGGTGCTGTGCTAGG + Intergenic
1174854143 20:54026865-54026887 AAGATGCCAAGTGCTGTGCTGGG - Intronic
1175360052 20:58402613-58402635 ACCATGCACTGTGCTGTGCTAGG - Intronic
1175789319 20:61731644-61731666 CACCTGCGCAGTTCTGGGCTTGG - Intronic
1175794834 20:61765132-61765154 TACCTGCCCAGTGCTGAGCAGGG - Intronic
1176155592 20:63618568-63618590 CTCATGCTCAGTGATATGCTAGG + Intronic
1176694475 21:9958415-9958437 CACAGGTACAGTGCTGTACTTGG - Intergenic
1176792299 21:13331830-13331852 CCCAAACCCTGTGCTGTGCTGGG - Intergenic
1176862841 21:14022185-14022207 AAGATGCCCAGTGAAGTGCTAGG + Intergenic
1177991697 21:28042696-28042718 CCCAAACCCTGTGCTGTGCTGGG - Intergenic
1182352424 22:29706340-29706362 TACGTGCCAGGTGCTGTGCTGGG - Intergenic
1182436286 22:30332649-30332671 CACAGGCCCAGTGTGCTGCTTGG - Exonic
1183090845 22:35520721-35520743 CACATGCCAAGCACTGGGCTGGG - Intergenic
1183591372 22:38781118-38781140 CACCTGCCCAGGGCTGGGCCAGG - Intronic
1183688359 22:39374811-39374833 CACATGCCCAGTGCCATCCATGG - Intronic
1183789564 22:40055105-40055127 GACATGCTGAATGCTGTGCTAGG + Intronic
1184247965 22:43245197-43245219 CTTATGGCCAGCGCTGTGCTGGG + Intronic
1184847675 22:47099131-47099153 CGCTTACCCTGTGCTGTGCTGGG + Intronic
1185408724 22:50672114-50672136 CACAGCCCCAGTGCTGGCCTGGG + Intergenic
1185414478 22:50702316-50702338 GACGTGCCAGGTGCTGTGCTGGG + Intergenic
950652346 3:14415175-14415197 CATGTGCCCAGTGCAGTGCCTGG + Intronic
950858004 3:16123411-16123433 CATATGCTCAGTGCTATGCTAGG - Intergenic
951546985 3:23836384-23836406 CACATGCCATGTGCTGTACTGGG + Intronic
952067260 3:29585604-29585626 CACATGTCGGTTGCTGTGCTAGG - Intronic
952902614 3:38120158-38120180 CAAATGCCCAGGGCTGTGGTTGG - Intronic
952927289 3:38329338-38329360 CAAATGCCCAGGGCTCTGGTTGG + Intergenic
953499224 3:43417010-43417032 CATGTGCCCAAAGCTGTGCTAGG + Intronic
954410031 3:50366483-50366505 CACAGGCCAAGGGATGTGCTGGG + Intronic
954688940 3:52385629-52385651 CCCCTGCCCAGTGCAGTGCCTGG - Intronic
955102710 3:55867322-55867344 CACATGCCAGGCCCTGTGCTAGG - Intronic
955459411 3:59164163-59164185 CACATGCAGAGTGATGAGCTTGG + Intergenic
955505626 3:59630347-59630369 TACATTCACTGTGCTGTGCTGGG + Intergenic
956197106 3:66664001-66664023 CACATGCCAGGTGCTGTGCTAGG + Intergenic
956601238 3:71024949-71024971 CTCATGGCCAGTGGTGTGCTGGG + Intronic
956887001 3:73570180-73570202 TACATGCCCATTGTTGTCCTTGG - Intronic
956898300 3:73686339-73686361 TACATGCCAGGTACTGTGCTAGG - Intergenic
957380216 3:79418017-79418039 AATGTGTCCAGTGCTGTGCTAGG - Intronic
960082379 3:113554826-113554848 CACATGCCCATGCCTGAGCTTGG - Intronic
960423358 3:117476305-117476327 CATATGCCAAGCTCTGTGCTAGG + Intergenic
960961305 3:123072353-123072375 CACGTGCCAAGCGCTGTGTTGGG - Intronic
961122121 3:124381757-124381779 CCCATGCCAAGTGCTGTGGCTGG - Intronic
962204706 3:133425319-133425341 TACATGCCAAGCACTGTGCTGGG + Intronic
962204707 3:133425325-133425347 CACGTGCCCAGCACAGTGCTTGG - Intronic
963038168 3:141050305-141050327 CACAGGCTCTGTGCTGTGATAGG + Intergenic
963332015 3:143925145-143925167 CACAGGCACAGTGGTGTGTTTGG + Intergenic
963668795 3:148225722-148225744 CACCTGTCAAGTGCTATGCTAGG + Intergenic
963850343 3:150204645-150204667 CACATGACCAGTGGTATGCCAGG + Intergenic
965384789 3:168032858-168032880 GTCATTCCCAGTGATGTGCTTGG - Intronic
967831158 3:193921329-193921351 TACATGCCCGGTGCTCTGGTAGG - Intergenic
968980536 4:3846734-3846756 CACATGCCCACTGCAGGGGTGGG + Intergenic
969050434 4:4369168-4369190 CTGATGCCCCGTGCTGTGCCTGG + Intronic
969226718 4:5803380-5803402 CACATGCCCAGAGATCTGCCAGG + Intronic
969450306 4:7269119-7269141 GCCAGGCCCTGTGCTGTGCTGGG + Intronic
969836420 4:9845973-9845995 TACATGTCAAGTCCTGTGCTAGG + Intronic
970191718 4:13524253-13524275 CACAGATCCAGTGCTCTGCTTGG + Intergenic
971139745 4:23911249-23911271 AATGTGCCCAGTGCTATGCTAGG - Intergenic
971354255 4:25880064-25880086 TATATGCCAAGTGTTGTGCTTGG - Intronic
972383119 4:38537376-38537398 CAAATGCCAGGTACTGTGCTAGG - Intergenic
973657695 4:53066974-53066996 TGCATGCCCAGCTCTGTGCTAGG - Intronic
974888317 4:67848710-67848732 CACATGCACAGTCCTGAGGTGGG + Intronic
974923764 4:68273370-68273392 CATTTGCTCAGAGCTGTGCTAGG + Intergenic
975993219 4:80282565-80282587 CACATGCCAGGCACTGTGCTAGG - Intronic
976333044 4:83853575-83853597 TAGATTCCAAGTGCTGTGCTAGG - Intergenic
977257970 4:94760768-94760790 CACATACCAGGTACTGTGCTGGG - Intronic
977676587 4:99755080-99755102 TATATGCCTAGTGCTGCGCTGGG + Intergenic
977866486 4:102034465-102034487 CACATGTCAAGTATTGTGCTGGG - Intronic
979394676 4:120172641-120172663 TAGATGCCTAGTGCTGTGCTTGG - Intergenic
979693254 4:123583228-123583250 TACATGCCCAGCTCTGTGTTGGG + Intergenic
983530677 4:168806982-168807004 CACGTGCCCGGAGCTGTGCTGGG + Intronic
984773742 4:183461978-183462000 CCCATGCCCAGTAATGTCCTGGG - Intergenic
985828158 5:2207978-2208000 CACTTCTCCAGAGCTGTGCTGGG - Intergenic
987737436 5:21865473-21865495 CACAAGCCCAGTGCTCTGGGAGG + Intronic
987822355 5:22981854-22981876 CACATGCCAAGGGCAGTGCTAGG + Intergenic
989013403 5:36900632-36900654 CATATGCTGGGTGCTGTGCTTGG - Intronic
989106937 5:37871712-37871734 TACATGCCTGGTGCTATGCTAGG - Intergenic
990004856 5:50934380-50934402 CAAATGCCCAGACCTGAGCTAGG - Intergenic
990448626 5:55915866-55915888 TACATGCCAGGTGCTGGGCTAGG + Intronic
991110685 5:62896347-62896369 CAGAGCTCCAGTGCTGTGCTGGG + Intergenic
991312926 5:65264799-65264821 TACATGCCAAGTGCTATTCTAGG - Intronic
992089505 5:73304450-73304472 CACTTGTCCAGTGCTGTGCTGGG + Intergenic
992261279 5:74973029-74973051 CAGATGCCCAGTGTTTTGCAAGG - Intergenic
992613345 5:78526589-78526611 CACAAGCCCACTGCTATTCTGGG - Intronic
993636099 5:90345644-90345666 CACATGCCCAGCACTGTTCTGGG - Intergenic
993786272 5:92141692-92141714 CACATGGCCAGGGCTATGCTTGG + Intergenic
996470298 5:123852628-123852650 CACATGCAAAGGGATGTGCTGGG - Intergenic
997392154 5:133525950-133525972 TACATGCTCAGCACTGTGCTGGG + Intronic
999137338 5:149331090-149331112 CTCATGCCAAGTGCTGTGTTGGG - Intronic
1001322338 5:170693121-170693143 CACATCCCCAATTCTGGGCTGGG - Intronic
1001570426 5:172727237-172727259 CCCATGCCTAGCGCAGTGCTGGG - Intergenic
1003034013 6:2627309-2627331 CAAATATCCAGTCCTGTGCTGGG + Intronic
1003201973 6:3969696-3969718 CACATGTACAGTGGTCTGCTAGG + Intergenic
1003298562 6:4855889-4855911 GAGATGCCCAGTACTGAGCTTGG - Intronic
1003429112 6:6022724-6022746 CACAAGGACAGGGCTGTGCTGGG + Intergenic
1003641487 6:7878974-7878996 CACATGCCAGGCTCTGTGCTAGG - Intronic
1003909228 6:10728239-10728261 TACATGTCAAGTGCTGTGCTAGG - Intronic
1003912454 6:10754728-10754750 TACATGTCAAGCGCTGTGCTAGG - Intronic
1004172697 6:13309407-13309429 ACCATGCCAAGTGATGTGCTAGG - Intronic
1004260988 6:14107645-14107667 TACATGCCCAATGCTATTCTTGG + Intergenic
1005589341 6:27309174-27309196 CACCTGCCCAGGGCTCTGTTGGG - Exonic
1006078280 6:31548303-31548325 CACAGGCCCGGTGCAGTGGTGGG - Exonic
1008602733 6:53111744-53111766 AGGCTGCCCAGTGCTGTGCTTGG - Intergenic
1009455228 6:63848736-63848758 CAGCTGCCCAGTTTTGTGCTTGG - Intronic
1009486166 6:64225059-64225081 CACATGTCCAGTGCTGGGGGCGG + Intronic
1010424728 6:75715232-75715254 CACATGCCAAGTACTGTGTTAGG - Intronic
1011583210 6:88895472-88895494 CACATGTCCGATGCTGTGCTTGG - Intronic
1011868285 6:91859859-91859881 TACATGCCCATAGCAGTGCTTGG - Intergenic
1012109138 6:95204413-95204435 CACATGCCCAGCCCTCTGCAAGG - Intergenic
1013321705 6:108997547-108997569 CAAATGCTAAGTGCTGTACTTGG + Intronic
1013900155 6:115145830-115145852 AACATAGCCAGTGGTGTGCTAGG - Intergenic
1015201863 6:130591952-130591974 GACATGCCAAGTACTGTGCTAGG + Intergenic
1015613900 6:135054904-135054926 CGCATGCGCACTGCTGTGCATGG + Intronic
1015684230 6:135841553-135841575 TACATGCCAGGTACTGTGCTAGG + Intergenic
1015776669 6:136821771-136821793 CAAATGCCTAGTACTGTTCTTGG + Intergenic
1015926215 6:138312552-138312574 CACCTGCTCACTGCTGTGCAGGG + Intronic
1016638496 6:146322407-146322429 CAGAGCTCCAGTGCTGTGCTGGG + Intronic
1017209645 6:151840897-151840919 TACATGCCAGGTACTGTGCTGGG + Intronic
1017751517 6:157493565-157493587 CACAGGCCCACTGCTGTGAGAGG + Intronic
1017905788 6:158756942-158756964 CAGGTGCCCAGTGCTCTGCCTGG - Intronic
1018041424 6:159926372-159926394 CACATGCCCAGAACTGTGGGAGG - Intergenic
1018186321 6:161267940-161267962 CCCATGCCCAGTGCAGAGCCTGG - Intronic
1019080544 6:169426774-169426796 CCTATGCTCAGCGCTGTGCTTGG - Intergenic
1019130134 6:169867331-169867353 CACGTGCTCGGTCCTGTGCTGGG + Intergenic
1019496001 7:1340983-1341005 CATCTTCCCAGTGCTGGGCTGGG - Intergenic
1019877929 7:3831788-3831810 CTCATGCCCAGTGCTTTGGGAGG + Intronic
1021014722 7:15518297-15518319 CAGAGCTCCAGTGCTGTGCTAGG - Intronic
1022809027 7:33850668-33850690 TATGTGCCAAGTGCTGTGCTAGG - Intergenic
1023356937 7:39376489-39376511 CACCAACTCAGTGCTGTGCTTGG + Intronic
1023830775 7:44037931-44037953 CACCTGCCCAGGGCTAGGCTGGG + Intergenic
1024046100 7:45586815-45586837 AACATGCCCAGTGCTGTGCAGGG + Intronic
1024626398 7:51211464-51211486 CACATGCCTGGCACTGTGCTCGG - Intronic
1025161570 7:56665809-56665831 CACAGCCTCAGTGTTGTGCTGGG - Intergenic
1025223746 7:57138740-57138762 CACAACCTCAGTGTTGTGCTGGG - Intronic
1025745917 7:64242675-64242697 CACAACCTCAGTGTTGTGCTGGG + Intronic
1027054271 7:75039269-75039291 CAAGTGCCCAGTGCCGTGCCTGG - Intronic
1027413907 7:77953291-77953313 CATATGCCAAGCCCTGTGCTAGG - Intronic
1027540574 7:79458951-79458973 CACAGACCCAGTGCTGTCCCTGG - Intergenic
1028102671 7:86840089-86840111 CACATGCAGAGCACTGTGCTAGG + Intronic
1028327075 7:89540587-89540609 CAGAGCTCCAGTGCTGTGCTGGG - Intergenic
1029185749 7:98737240-98737262 CACATGGCCGGTTCTGTGCCTGG - Intergenic
1029741112 7:102492247-102492269 CACCTGCCCAGGGCTAGGCTGGG + Intronic
1029759104 7:102591417-102591439 CACCTGCCCAGGGCTAGGCTGGG + Intronic
1029940651 7:104477364-104477386 CACATGCCAGGCACTGTGCTTGG + Intronic
1031018092 7:116597244-116597266 CACAGGCCAAGTTCTATGCTAGG + Intergenic
1032012969 7:128359086-128359108 TACGTGCCAAGCGCTGTGCTAGG - Intronic
1033848265 7:145462234-145462256 TACATGCCAAGTGCTGAGCATGG - Intergenic
1034370010 7:150586787-150586809 GAAATGCCCAGTGCTGTCTTTGG - Intergenic
1034539049 7:151744424-151744446 CAGATGCCCACTGCAGTGGTGGG - Intronic
1037907218 8:22722691-22722713 CATGTGCCCAGCGCTGTGCTGGG - Intronic
1038340630 8:26682467-26682489 CACAACCCCAGTTCTATGCTTGG - Intergenic
1038532178 8:28327425-28327447 CACATGCCAGGGCCTGTGCTTGG + Intronic
1039754785 8:40511951-40511973 CAGAGCTCCAGTGCTGTGCTGGG + Intergenic
1039846295 8:41328094-41328116 CCCATGCCCAGCGAGGTGCTTGG - Intergenic
1039890498 8:41682499-41682521 CACATGCCAGGCACTGTGCTAGG - Intronic
1041662390 8:60412892-60412914 CTCCTGCCCAGTGCTGGGCAAGG + Intergenic
1041758572 8:61339473-61339495 CACAGGCCCAGCTCTGGGCTGGG - Intronic
1041897354 8:62940334-62940356 CACCTGCCTAGTGCTGTCCATGG - Intronic
1042623233 8:70728881-70728903 TACAAGCCCACGGCTGTGCTCGG - Intronic
1044748954 8:95398210-95398232 CATGTTCCAAGTGCTGTGCTAGG + Intergenic
1044930167 8:97244630-97244652 CACCTGCCAGGTGCTTTGCTGGG - Intergenic
1044963780 8:97556317-97556339 CACGTGCCAAGTGCTGTGCTGGG + Intergenic
1046789672 8:118307543-118307565 CACATGCCTGGGGCTCTGCTAGG + Intronic
1047494514 8:125400003-125400025 CACGTGCTGAGTGCTGTGCATGG + Intergenic
1048293349 8:133196955-133196977 CACATGCCCAGCACTGAGCCAGG - Intronic
1048342157 8:133548526-133548548 CACATGCCAAGTGGTGTGCTGGG - Intronic
1048348966 8:133600389-133600411 CAAAAGCCAGGTGCTGTGCTTGG - Intergenic
1048486026 8:134848172-134848194 CCCCTGCCCAGTGCCATGCTTGG - Intergenic
1048853027 8:138662482-138662504 CATATGCTGAGTGTTGTGCTGGG - Intronic
1048854811 8:138677353-138677375 CTCAGGTTCAGTGCTGTGCTGGG - Intronic
1049012745 8:139898199-139898221 AGCCTGCCAAGTGCTGTGCTGGG - Intronic
1049312004 8:141938291-141938313 CACGTGCACAGGGCTGTGCCGGG - Intergenic
1050563243 9:6856073-6856095 CTCATGCCAAATGCTGTGCCAGG - Intronic
1050618696 9:7429940-7429962 GCAATTCCCAGTGCTGTGCTGGG - Intergenic
1051836929 9:21349470-21349492 CACATGACCACTGCTGTTCCTGG + Intergenic
1053132816 9:35627767-35627789 AAAATCCCCAGTGCTGTGGTTGG - Intronic
1053209824 9:36218348-36218370 CACAGGCCCAGTGGTGAGCTTGG - Intronic
1054936766 9:70696409-70696431 AACAGGCTCAGTGCTGTCCTGGG + Intronic
1054958447 9:70940496-70940518 CATATGCTAAGTGCTATGCTAGG + Intronic
1055257474 9:74388162-74388184 CATATACCCAGTTCTGTGATTGG + Intergenic
1056430891 9:86526791-86526813 CACATGCCCAGTGTTCTTCAAGG - Intergenic
1057961900 9:99465140-99465162 CACATGCACAGAGCTGCGCAAGG - Intergenic
1058635712 9:107036522-107036544 CACTTCCCCAGTGCTGGGTTGGG + Intergenic
1059088908 9:111334918-111334940 CAAAGCTCCAGTGCTGTGCTGGG - Intergenic
1060014195 9:120072095-120072117 CCCATGCCCAGTGCCGTGCTTGG + Intergenic
1060080589 9:120640527-120640549 CACATGCCAGGCACTGTGCTAGG - Intronic
1060230459 9:121821754-121821776 TGCATGCCCAGCACTGTGCTGGG - Intergenic
1060587272 9:124794467-124794489 CACGTGCCAGGCGCTGTGCTAGG - Intronic
1061138851 9:128752285-128752307 CCTCTGCCAAGTGCTGTGCTGGG - Intronic
1061273207 9:129555578-129555600 CCCGTGCCAAGTCCTGTGCTGGG + Intergenic
1061490688 9:130942289-130942311 CTCACGCTCAGCGCTGTGCTGGG + Intergenic
1061601400 9:131672642-131672664 CATGTGCCCTGGGCTGTGCTGGG - Intronic
1061626584 9:131844093-131844115 CAGGTGCCCAGTGCTGTGCCAGG + Intergenic
1061923475 9:133794753-133794775 CACATGCCAGGTGCTGTGCCTGG + Intronic
1062145923 9:134989622-134989644 CACGTGCCCCGTGGTGAGCTGGG - Intergenic
1062158856 9:135068877-135068899 CCCAGGCTCTGTGCTGTGCTGGG - Intergenic
1062277855 9:135739145-135739167 CCCCTGCCCAGTGCAGTGCTAGG - Intronic
1062359759 9:136182149-136182171 CACCAGCCCAGGGCTGTGCAGGG - Intergenic
1062452794 9:136622579-136622601 CACCTGCCTTGGGCTGTGCTGGG - Intergenic
1187257025 X:17652998-17653020 CAGATGCCAGGTACTGTGCTGGG - Intronic
1187828560 X:23357520-23357542 TATATACCCAGTGATGTGCTGGG + Intronic
1188664685 X:32804600-32804622 CAGAGCTCCAGTGCTGTGCTGGG - Intronic
1189497505 X:41522260-41522282 CGCATGCCCACTGCAGTGCCAGG - Intronic
1189566927 X:42251625-42251647 CACACGCCAAGTTCTGTGATGGG - Intergenic
1190234794 X:48607065-48607087 CCCAAGCCCAGTGATTTGCTAGG + Exonic
1190375410 X:49784162-49784184 TACATGCCAAGCGCTGTACTAGG - Intergenic
1191687686 X:63909507-63909529 CACATGCCCAATTCTTTGTTTGG + Intergenic
1191799874 X:65066654-65066676 CACAGCTCGAGTGCTGTGCTGGG + Intergenic
1191810057 X:65176513-65176535 CAGAGCTCCAGTGCTGTGCTGGG - Intergenic
1191959384 X:66683474-66683496 TACATGCCCAGCACTGTGCTAGG - Intergenic
1192317190 X:70062267-70062289 CAAATGCCCAGTGCTAGGATTGG - Intergenic
1192546903 X:72021887-72021909 CACATGCCAAGTAAAGTGCTGGG - Intergenic
1192966482 X:76182794-76182816 CAGAGCCCCAGCGCTGTGCTGGG + Intergenic
1193533678 X:82686834-82686856 AACCTGCCCAGCTCTGTGCTTGG + Intergenic
1194787529 X:98105760-98105782 GAGAGACCCAGTGCTGTGCTGGG - Intergenic
1195715281 X:107812360-107812382 AACATGCCCTGTCCTGGGCTGGG - Intergenic
1196889994 X:120282559-120282581 CTCATGCCCAGCCCTGTGCTGGG + Intronic
1197968845 X:132093944-132093966 CACATGCCCATCACTGTGTTAGG - Intronic
1198496033 X:137194471-137194493 CTCATGCCAAGTTCTGTGCCAGG + Intergenic
1199207977 X:145171783-145171805 CACATGACCACAGCTCTGCTGGG + Intergenic
1199697859 X:150356128-150356150 CACATGGCTAGTTCTGTGCCTGG - Intergenic
1201447806 Y:14077502-14077524 TACATGCCAAGTGCTATGCTTGG + Intergenic