ID: 1146377923

View in Genome Browser
Species Human (GRCh38)
Location 17:32307218-32307240
Sequence CCCAGCCATATGCCAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146377923_1146377927 -9 Left 1146377923 17:32307218-32307240 CCAGTACCTGGCATATGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1146377927 17:32307232-32307254 ATGGCTGGGAGCATGGTAGATGG 0: 1
1: 0
2: 3
3: 39
4: 299
1146377923_1146377931 22 Left 1146377923 17:32307218-32307240 CCAGTACCTGGCATATGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1146377931 17:32307263-32307285 AGATTTTAGTGAATGAAGGAAGG 0: 1
1: 1
2: 2
3: 42
4: 403
1146377923_1146377930 18 Left 1146377923 17:32307218-32307240 CCAGTACCTGGCATATGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1146377930 17:32307259-32307281 CACTAGATTTTAGTGAATGAAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1146377923_1146377932 26 Left 1146377923 17:32307218-32307240 CCAGTACCTGGCATATGGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1146377932 17:32307267-32307289 TTTAGTGAATGAAGGAAGGAAGG 0: 1
1: 5
2: 20
3: 201
4: 1444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146377923 Original CRISPR CCCAGCCATATGCCAGGTAC TGG (reversed) Intronic
900457769 1:2785769-2785791 CCCAGTCTTGTGCCAGGCACAGG - Intronic
900511010 1:3061170-3061192 CCCAGCCTTGGGCCAGGTGCTGG + Intergenic
901064743 1:6489385-6489407 CCCTGCCATCTGCCCGGCACAGG - Intronic
901239087 1:7682538-7682560 CACAGCCACATGCCAGGGACAGG - Intronic
901838378 1:11938619-11938641 CCCATCCATCTGCCAGGGAAAGG - Intronic
901847102 1:11990422-11990444 GCCAGCCGTGTGCCAGGTGCTGG + Intronic
902090380 1:13898280-13898302 CGCAGCCAAATGCCAGGTCAGGG - Intergenic
902471420 1:16649374-16649396 CCCAGCCATATGCCTCTCACGGG + Intergenic
902487390 1:16758071-16758093 CCCAGCCATATGCCTCTCACGGG - Intronic
902643416 1:17781119-17781141 TGCAGCCACATGCCAGGAACAGG - Intronic
904290842 1:29485092-29485114 CCCTGCCATTTGCTAGGTCCTGG - Intergenic
904321400 1:29699757-29699779 CCCTGCTCTGTGCCAGGTACTGG + Intergenic
904773012 1:32891372-32891394 CCCAGCCCTCTGCCAGGTAATGG + Intronic
904993556 1:34613421-34613443 CCCAGCGCTGTGCTAGGTACTGG - Intergenic
906468971 1:46111130-46111152 ACCTGCTATATGCCAGATACTGG + Intronic
906871456 1:49486355-49486377 ACCAGCTGTATGCTAGGTACTGG - Intronic
907383605 1:54111101-54111123 CCAAGCCCTATGCCAAGGACTGG - Intronic
909344720 1:74571986-74572008 CCCAGCCACAGGCCAGGCAGAGG - Exonic
909698994 1:78499443-78499465 CCCAACTATATGCCAGGCACTGG - Intronic
910210080 1:84783457-84783479 CCAAGCCCTATGCCAGGTGAGGG + Intergenic
912682505 1:111738473-111738495 CCCAGCCAGATGTCAGGTCTGGG - Intronic
914785943 1:150830966-150830988 ACCTGCCATATGCCAGGCACTGG + Intronic
915265602 1:154714707-154714729 ACCAGCCACATGCCAGGAATTGG - Intronic
915937530 1:160098201-160098223 CCCAGCTCTAAGCCAGGGACTGG - Intronic
916699663 1:167278406-167278428 CCCTACCATGTGCCAGGTGCTGG - Intronic
918118291 1:181515823-181515845 ACCAACTATATGCCAGGCACTGG - Intronic
922096339 1:222446053-222446075 ACCCACCATATGCCAGGAACAGG - Intergenic
922212824 1:223498582-223498604 ACCTTCCATATGCCAGGCACTGG - Intergenic
923467494 1:234262428-234262450 GCCAACCACATGCCAGGCACTGG - Intronic
1069639713 10:69946729-69946751 CCCAGCCACAGGCCAGGACCTGG + Intronic
1069793468 10:71038346-71038368 CCCACCCATGTGGCAGGGACAGG - Intergenic
1070076667 10:73143086-73143108 CCAGGCCCTATTCCAGGTACTGG - Intronic
1072820400 10:98550941-98550963 CTCAACCATAAGCCAGGTACTGG - Intronic
1074097038 10:110322944-110322966 CCCAGCTATTTGCCATGTTCTGG - Intergenic
1074123707 10:110511945-110511967 GTCTGCCATATGCCAGGCACTGG - Intergenic
1074768189 10:116716058-116716080 GCCAGCCAGATCTCAGGTACAGG + Intronic
1075401137 10:122162669-122162691 GCCTGCCATAGGCCAGGGACAGG + Intronic
1076139629 10:128068825-128068847 CCCACCCAGATGCCAGTCACAGG - Intronic
1076692627 10:132231475-132231497 GCCAGCCCCATGCAAGGTACTGG + Intronic
1077229745 11:1453462-1453484 CCCAGCCCCATGCCAGGGCCTGG - Intronic
1078083522 11:8220363-8220385 CCGGCCCATCTGCCAGGTACTGG - Intergenic
1078750985 11:14163547-14163569 CCCAGCCCTTTGCCAGGTATGGG - Intronic
1081766933 11:45617810-45617832 GCCTGCCATGTGCCAGGCACAGG - Intergenic
1082955220 11:58863573-58863595 CCCAGCCCTAGGCCAGCTTCAGG - Intronic
1085269829 11:75263646-75263668 CTCAGCTCTATGCCAAGTACTGG - Intergenic
1085417823 11:76330895-76330917 CCCAGCCCTGTCCCAGGCACTGG - Intergenic
1085764287 11:79269731-79269753 CCCAGACAGATGCCAATTACAGG + Intronic
1088516218 11:110637614-110637636 ACCAGCCATGTGCCAGGCATAGG + Intronic
1088847852 11:113682708-113682730 CCCAGCCACATGCCAGGCTCAGG - Intergenic
1089485469 11:118842542-118842564 CCCAATCCTGTGCCAGGTACAGG + Intergenic
1090187225 11:124746479-124746501 CCCAGCAACCTGCCAGCTACAGG + Exonic
1090497311 11:127226234-127226256 CCCTGCTAAATGCCATGTACTGG + Intergenic
1092981849 12:13803360-13803382 GCCTGTCACATGCCAGGTACTGG + Intronic
1093371911 12:18376011-18376033 CCCAGCCATAAGCCTGCTACAGG + Intronic
1094554601 12:31485877-31485899 CCTAGCTATATGCCTGGTCCAGG + Intronic
1094723282 12:33087152-33087174 GCCTGCCATGTGCCAGGCACTGG + Intergenic
1095721508 12:45406179-45406201 CCCTGTCATATGCCAGGTACTGG - Intronic
1095792834 12:46185903-46185925 CCCAGCCACATCCCACCTACTGG - Intronic
1096271782 12:50171326-50171348 CCCAGCCATTTGCGAGGCCCAGG - Intergenic
1096422278 12:51469092-51469114 CCAAGCACTGTGCCAGGTACTGG - Intronic
1096489389 12:52005512-52005534 CCCTGCTGTGTGCCAGGTACTGG - Intergenic
1096531194 12:52243918-52243940 CCCTGCCATGTGCCAGGTGCTGG - Intronic
1096642791 12:53007337-53007359 CGCAGCTATATGCCAGGATCAGG + Intronic
1099225287 12:79961927-79961949 CCAAGCCCTATGCCAGGTGCTGG + Intergenic
1099906994 12:88783139-88783161 CTAGGCCATATGCTAGGTACAGG - Intergenic
1100619907 12:96260966-96260988 CCAAGCCATGTGCCAGATGCTGG - Intronic
1101707590 12:107235003-107235025 CCTTACCATAAGCCAGGTACTGG - Intergenic
1102009811 12:109611420-109611442 CACAGACATATGCCAGGCTCTGG - Intergenic
1102030866 12:109739399-109739421 GCCAGCCCTGTGCCATGTACTGG - Intronic
1102287049 12:111666159-111666181 TCCAGCACTGTGCCAGGTACTGG + Intronic
1104323954 12:127778191-127778213 CACATTCATATGCCAGGCACAGG - Intergenic
1104350312 12:128039508-128039530 CAAAGCAATATGCCAGGTGCTGG + Intergenic
1104412930 12:128574336-128574358 ACCAGCTACATGCCGGGTACTGG + Intronic
1105775744 13:23658689-23658711 CCCTGCCACATGCCAAGTACTGG + Intronic
1107723444 13:43273627-43273649 CCCAACCATATGCCTGGTGAGGG - Intronic
1109527013 13:63588929-63588951 CCCAGCCATGTGCGAGGCAGAGG - Intergenic
1112211803 13:97385182-97385204 CCCAGCCCTATCCTAGATACTGG + Intronic
1113244256 13:108377049-108377071 CCCAGCCACATGCCCAGTTCTGG - Intergenic
1113608988 13:111629861-111629883 CCCACCCAAATGCCATGGACAGG - Intronic
1114496861 14:23138883-23138905 CCCAGCCTGATGCCAGGTGAGGG + Intronic
1118439558 14:65800111-65800133 CCCAGCCATCTCCCAGGTTTTGG - Intergenic
1118985985 14:70755157-70755179 GCTTGCCCTATGCCAGGTACTGG - Intronic
1119128353 14:72149313-72149335 CCCAGCCATATTCAGGGTAAGGG + Intronic
1119328206 14:73774818-73774840 ACCAGACATAGGCCAGGTCCTGG + Intronic
1119765961 14:77187758-77187780 CCCAGCCCTATCCCAGGGCCTGG + Intronic
1122691583 14:103534292-103534314 CCCTCCCATGTGCCAGGCACCGG - Intronic
1126070338 15:44860377-44860399 GCCTGCCATGTGCCAGGCACTGG - Intergenic
1126087697 15:45024740-45024762 GCCTGCCATGTGCCAGGCACTGG + Intronic
1126345701 15:47691774-47691796 GCCCACCATATGCCAGGTGCTGG + Intronic
1126482033 15:49135346-49135368 CCCTTCCACATGCCAGGCACTGG + Intronic
1128334799 15:66779062-66779084 CCCAGCCATCTACCTGGCACAGG - Intronic
1128712658 15:69883893-69883915 CCAAGCCATCTGCCTGGTTCAGG - Intergenic
1129750394 15:78058863-78058885 CCCAGCAAGAAGCCAGGTGCTGG + Intronic
1130770303 15:86917288-86917310 CCCAGGCAGAGGCCAGGGACAGG - Intronic
1130929111 15:88409173-88409195 CCCAACTATATGCCATCTACAGG - Intergenic
1131037001 15:89229413-89229435 CCAGGCCCTATGCCAGGTACTGG + Intergenic
1131360003 15:91782270-91782292 CTCAGCCAGATGCCAGTTTCAGG + Intergenic
1132792422 16:1699160-1699182 CCCAGCCATCTGGAAGGCACGGG - Exonic
1134237348 16:12477568-12477590 CCCTGCTCTATGCCAGGAACTGG + Intronic
1134517533 16:14899196-14899218 ACCCGCCACATGCCAGGGACTGG - Intronic
1134629042 16:15743762-15743784 CCCAGGCACATGCTAGGTGCTGG - Intronic
1134630415 16:15752228-15752250 CCTAACCATATGCCAGGCTCTGG - Intronic
1134705201 16:16297847-16297869 ACCCGCCACATGCCAGGGACTGG - Intergenic
1134962340 16:18414267-18414289 ACCCGCCACATGCCAGGGACTGG + Intergenic
1134966637 16:18496866-18496888 ACCCGCCACATGCCAGGGACTGG + Intronic
1135569186 16:23535230-23535252 TCCAGCCATAGACCAGGTCCTGG + Exonic
1135680026 16:24448403-24448425 ACCATGCATATGCCAGGCACTGG - Intergenic
1136849066 16:33599510-33599532 CGCAGCCATGAGCCAGGTGCTGG + Intergenic
1137789667 16:51164507-51164529 ACCAACCATATGCCTGGTACTGG - Intergenic
1138474355 16:57262001-57262023 CCCAGCCATAGGCCGGATACAGG + Exonic
1138704665 16:58902588-58902610 CCCAGGACTATGCCAGGAACTGG + Intergenic
1139301734 16:65950713-65950735 ACCAGCACTATGCCAGGCACTGG + Intergenic
1139446591 16:67001914-67001936 CCCAGCCATATGCCCCTCACAGG - Intronic
1140042371 16:71416567-71416589 CTCAAACATATGCCAGTTACTGG - Intergenic
1140143053 16:72277831-72277853 CCCTGCTATATGCCAGATACTGG + Intergenic
1203110773 16_KI270728v1_random:1448160-1448182 CGCAGCCATGAGCCAGGTGCTGG + Intergenic
1143480910 17:7226886-7226908 ACAAGCCATGTGCCAGGTGCAGG - Intronic
1145009683 17:19360830-19360852 CCCAGCCCTGTGCCAGGCAGTGG - Intronic
1145875639 17:28316961-28316983 CTCAGCCAAGTGCCAGTTACTGG - Intergenic
1146377923 17:32307218-32307240 CCCAGCCATATGCCAGGTACTGG - Intronic
1147261213 17:39210627-39210649 CCCAGCAATATCCCAGGGGCGGG - Exonic
1149511029 17:57241930-57241952 TCCAGCTCTGTGCCAGGTACTGG - Intergenic
1150122820 17:62617798-62617820 CCTAGCCATATGCAAGGTAGGGG + Intergenic
1153934596 18:9910083-9910105 CCCAGCACTGTGGCAGGTACTGG - Intergenic
1154103630 18:11500177-11500199 GCCTGCTATATGCCAGGTCCTGG - Intergenic
1158209122 18:55026422-55026444 ACCAGCCATAGGCCAAGCACGGG - Intergenic
1162042286 19:7978130-7978152 CCAAGCCCTCTGCCAGGTGCTGG - Intronic
1163033003 19:14556587-14556609 CACTGCCATATCCCAGGAACTGG + Intronic
1164425695 19:28139451-28139473 CCCAGCCATGTTCCAGCCACAGG + Intergenic
1166850149 19:45756063-45756085 CCCAGCCCCATCCCAGGTAAGGG + Exonic
1168363180 19:55760315-55760337 CCCAGCCAGTTTCCAGGTTCTGG + Intronic
1168364129 19:55770316-55770338 CCCAGCCAGTTTCCAGGTTCTGG + Intronic
1202703818 1_KI270713v1_random:6169-6191 CCCAGCCATATGCCTCTCACGGG + Intergenic
925144710 2:1573233-1573255 CCCAGCCCTGTGCCAAGGACGGG + Intergenic
925689851 2:6510739-6510761 CAAAGCCATATGGGAGGTACTGG - Intergenic
926344265 2:11930978-11931000 GCCAGCCATGTGCCAGGCACTGG - Intergenic
926410165 2:12594794-12594816 CCCAGCCAGCTTCCAGGTCCAGG + Intergenic
927403141 2:22737202-22737224 CCAAACCATATATCAGGTACGGG - Intergenic
927853209 2:26512819-26512841 ACCTGCCACATGCCAGGCACAGG + Intronic
929650731 2:43677798-43677820 CCCAGCCAGCTGCCCGGTGCGGG - Intronic
931690214 2:64829346-64829368 CCCAGCCCCATGCCATGGACTGG - Intergenic
931945402 2:67300650-67300672 TCTAACCATATCCCAGGTACTGG - Intergenic
933848975 2:86350194-86350216 CCCAGCCATAGGCCAGGGAAGGG + Intergenic
936606469 2:113961982-113962004 CCAAGCAATATGTCAGGCACTGG - Exonic
937316852 2:120937189-120937211 GCCAGCCTCATGCCAGGCACTGG + Intronic
941939079 2:171014165-171014187 GCCTGCCATATGTCAGGCACTGG + Intronic
943504527 2:188737346-188737368 ACCTACCATATGCCAGATACTGG - Intronic
944695514 2:202197004-202197026 CCCAGGAACAAGCCAGGTACTGG + Exonic
946050753 2:216860301-216860323 CCCAGCCCTGTGCCAGGCATTGG + Intergenic
947958826 2:234217657-234217679 CCCAACCCTTTGCCAGGTACAGG + Intergenic
948308955 2:236970901-236970923 CTCAGTCCTGTGCCAGGTACTGG - Intergenic
1170730377 20:18969768-18969790 TCTAGCCATATTCCAGGAACAGG - Intergenic
1170815837 20:19713575-19713597 CCCAGCCCTCTGCCAGGTGGAGG + Intronic
1173565985 20:44039073-44039095 CCCAGCCCTCTGCCTGGTGCTGG + Intronic
1174404234 20:50293358-50293380 GCCAGCTATGTGCCAGGTGCTGG - Intergenic
1175072572 20:56346532-56346554 CCCAGCGCTATGCCAGGCGCTGG - Intergenic
1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG + Intergenic
1175757511 20:61538932-61538954 TCCTGCCTGATGCCAGGTACAGG + Intronic
1175760848 20:61561408-61561430 CCCAGCCACATGGCGGGTGCAGG + Intronic
1177130796 21:17252587-17252609 CCCAGGCATCTGCCAAGTTCTGG - Intergenic
1178755199 21:35342874-35342896 TCCAGTCATATGCCAGATATGGG + Intronic
1179537199 21:42060341-42060363 TCCAGCCACACGCCAGGTCCCGG - Intergenic
1180159566 21:45992978-45993000 CCCAGCCATGTGCCTGATGCTGG + Intronic
1181828911 22:25543192-25543214 GCCAGCCATGTGTCAGGTGCTGG - Intergenic
1182373740 22:29830758-29830780 CCAGGCCATGTGCCAGGTGCTGG - Intronic
1183605451 22:38864908-38864930 CCCAGCCTTAGGCCAGGCCCTGG - Exonic
1183826353 22:40390927-40390949 CCCTGCCACATGTCAGGCACTGG + Intronic
949905177 3:8852930-8852952 GCGTGCCATATGCCAGGTGCTGG + Intronic
950108020 3:10400578-10400600 ACCAGCTGTGTGCCAGGTACTGG - Intronic
951687517 3:25361871-25361893 ACCAGCCATATGCCAGCTGGAGG + Intronic
951806940 3:26655796-26655818 GTCTGTCATATGCCAGGTACTGG + Intronic
953374838 3:42419971-42419993 CCCACCCATAGGCCAGGGGCAGG - Intergenic
953720825 3:45353495-45353517 CCCTGCCATGTTCCAGGCACTGG - Intergenic
953999142 3:47542479-47542501 CCCTGCCAAATGCCAGACACCGG - Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954128464 3:48547045-48547067 TCCAGCTATATGCCAAGTCCTGG + Intronic
954298010 3:49684867-49684889 CCCAGCCATATGCCTCTCACGGG - Exonic
954346591 3:50004877-50004899 CCCAGCAATTTGGCAGGTCCAGG - Intronic
954428738 3:50457996-50458018 CTCAGCCACCTGCCAGGTTCAGG + Intronic
955780302 3:62477516-62477538 TCCTCCCATATGCCAGGCACAGG - Intronic
956736209 3:72240197-72240219 ACCTGCTGTATGCCAGGTACTGG - Intergenic
961452918 3:127010536-127010558 CCCTGCCCTCTGCCAGGTGCAGG - Intronic
961646678 3:128396480-128396502 CCAAGCCCTGTGCCAGGCACTGG + Intronic
961930700 3:130529843-130529865 CCCTGCCATATACCAGGTGTTGG - Intergenic
963046218 3:141104502-141104524 CCCAGCCATCTGCCATGCAGAGG - Intronic
963810058 3:149767564-149767586 CCCAGCCTTATGCCAGCTCTTGG + Exonic
964630131 3:158801615-158801637 TCCAGCCATGTGTCACGTACTGG - Intronic
965460025 3:168951223-168951245 CCCAACTATGTGCCAGGCACTGG + Intergenic
965928110 3:174008181-174008203 GCCAGGCAAATGCCAGGTAGAGG + Intronic
968062898 3:195739651-195739673 CCCAGCCTTCTCCCAGGTATTGG + Intronic
968311165 3:197684072-197684094 CCCAGCCATACACCAAGAACTGG + Intronic
969941539 4:10736840-10736862 CCCAACCTTCTGCCAGGTGCTGG - Intergenic
970245429 4:14056852-14056874 CCCAACCATCTGACAGGTCCTGG + Intergenic
971456459 4:26849983-26850005 GGCTGCTATATGCCAGGTACAGG + Intergenic
973030004 4:45325937-45325959 TCCAGCCAGATGCCAGAAACAGG - Intergenic
973652524 4:53010584-53010606 CCCAGAACTGTGCCAGGTACTGG - Intronic
974389375 4:61245603-61245625 GCCAACCATGTGCCAAGTACTGG - Intronic
975266504 4:72375362-72375384 CCCAGCACTCTGCCAGGTGCTGG + Intronic
975314564 4:72936672-72936694 ACCAGCAATATGCTAGGCACTGG - Intergenic
977835812 4:101645310-101645332 ACCAGGTATTTGCCAGGTACTGG + Intronic
984520023 4:180790259-180790281 CCCAAACATTTGCCAGTTACAGG + Intergenic
984930265 4:184841060-184841082 CCAAGCTATATGCTAGGTGCTGG - Intergenic
986805292 5:11303153-11303175 AGCTGCCAAATGCCAGGTACTGG - Intronic
987419821 5:17706103-17706125 GCCTACCATATGCCAGGCACTGG - Intergenic
990093607 5:52085024-52085046 CCAAGCCATATTCTGGGTACTGG + Intergenic
990965332 5:61440799-61440821 GCCAGCCATGTGCCTGGTCCTGG + Intronic
993128361 5:83863331-83863353 CCCAACCCTATGCCAGGCACTGG + Intergenic
997173910 5:131754143-131754165 CACAGCATAATGCCAGGTACTGG + Intronic
999070545 5:148739220-148739242 CTCAGCCATGTGCCAGCTAAAGG - Intergenic
999154539 5:149448991-149449013 CCCAGCCCTGTGCCAGGGAGAGG - Intergenic
999339837 5:150760860-150760882 CCCTGCTACATGCCAGGTACTGG + Intergenic
999503051 5:152165922-152165944 CCCAGCCATATCACAGGAAAGGG + Intergenic
999914019 5:156237811-156237833 CCCAACTATGTGCCAGATACTGG + Intronic
1001595378 5:172895522-172895544 CCCAGCCCCAGGCCAGGCACTGG + Intronic
1004286998 6:14330330-14330352 CCCAGCCATCTTCCAGGCAGAGG - Intergenic
1006146041 6:31960304-31960326 CCCAACCACAGGCCAGATACTGG + Exonic
1006633004 6:35442789-35442811 CCCAGCACTATGGCAGGCACAGG - Intergenic
1007407499 6:41643461-41643483 CCCAGCAATATGACAAGTATTGG - Intronic
1007782071 6:44260138-44260160 CCCGGCCAGCTGCCAGGTGCAGG + Exonic
1008048918 6:46880226-46880248 TCCTGCCACATGCCAGGGACAGG + Intronic
1010239395 6:73601657-73601679 CCCAGCCAGATGCCCCGTCCAGG + Intronic
1010278262 6:73993687-73993709 CCCAACCCTGTTCCAGGTACTGG - Intergenic
1010590640 6:77707951-77707973 CCCAGCCAGAAGCCTGCTACAGG + Intronic
1011494613 6:87925874-87925896 CCCAGCCCTCTGCTAGCTACTGG + Intergenic
1013673674 6:112433406-112433428 TCCTCCCATATGTCAGGTACTGG + Intergenic
1021653253 7:22851955-22851977 CAAAGCCCTAGGCCAGGTACTGG + Intergenic
1021757952 7:23873665-23873687 CCTAGCAGTATGCCAGATACTGG + Intergenic
1021917390 7:25448419-25448441 CCCAGCCATATACTACTTACAGG - Intergenic
1021941435 7:25682642-25682664 CCCAGCAATATTCCATGTTCTGG + Intergenic
1022416070 7:30178149-30178171 CCAGGCATTATGCCAGGTACTGG - Intergenic
1023309199 7:38866441-38866463 CCCAGCCATTTGCTAAGTCCTGG - Intronic
1026382521 7:69813784-69813806 GCCTGCCATATGCCAAGCACAGG - Intronic
1028693001 7:93675005-93675027 CCCAACCCCATGACAGGTACTGG - Intronic
1028896927 7:96052073-96052095 CCAAGCACTATGCCAGGTAATGG - Intronic
1029346283 7:99980946-99980968 CCCTGGCATATGGCAGGAACAGG + Intergenic
1030006823 7:105128279-105128301 CTCAGACCTATGCCAGGTTCAGG - Intronic
1032261874 7:130344873-130344895 CCCACCCTTAAGCCAAGTACAGG + Exonic
1036147700 8:6269946-6269968 GCCTGCCATGGGCCAGGTACTGG + Intergenic
1038834673 8:31106219-31106241 CCCTGCCATTCCCCAGGTACGGG + Intronic
1041007079 8:53505782-53505804 CCCAGCCATATGCTAGAGGCTGG - Intergenic
1045760531 8:105601278-105601300 CCCTACCATGTGCCAGCTACTGG - Intronic
1047371805 8:124262116-124262138 CTCTGACATATGCCAGGTGCTGG + Intergenic
1048446321 8:134496129-134496151 CTCAGCCACGTGCCAGGCACAGG + Intronic
1048452017 8:134541870-134541892 CCAAGCAATATGTCAGGAACTGG + Intronic
1050561792 9:6841800-6841822 CTTAGCCATTTGCCAGGCACAGG - Intronic
1051342283 9:16122592-16122614 CCCAGCCATTCACCAGGCACTGG + Intergenic
1055124391 9:72702505-72702527 CCCAGCTATGTGCCAAGTTCTGG - Intronic
1056077917 9:83060520-83060542 GCCTGCCATATGCCAAATACTGG - Intronic
1056128545 9:83561995-83562017 CCCAGCACAATGCCTGGTACAGG + Intergenic
1058003414 9:99890463-99890485 CCCAGTCATGTACCAGGTGCTGG + Intergenic
1058903640 9:109462813-109462835 CCCAGCTTTGTGCCAGGCACGGG + Intronic
1059753426 9:117270591-117270613 AACATCCTTATGCCAGGTACAGG - Intronic
1060149452 9:121279026-121279048 CCCAGCCCTAGGCCAGGCTCTGG + Intronic
1062277317 9:135737048-135737070 CCCAGCTCTGTGCCAGGCACTGG + Intronic
1186663447 X:11693604-11693626 CCCAGCAATCTGGCAGGAACAGG - Intergenic
1188015669 X:25105185-25105207 CCCAGCCCTATGCAAAGCACTGG + Intergenic
1189204137 X:39223197-39223219 GCTTGCTATATGCCAGGTACTGG + Intergenic
1189748499 X:44194758-44194780 CCCAGCCATATTCCAGCTTAGGG + Intronic
1189870914 X:45381870-45381892 CCCAGCCATAGGCCGGGTACAGG + Intergenic
1190747795 X:53335838-53335860 CCCAGCCATCTTTCAGTTACTGG - Intergenic
1192040580 X:67616765-67616787 CCAAGCCATGTGCTAGGCACAGG + Intronic
1198644491 X:138790882-138790904 ACCAGCCTTATGTCAGGTGCTGG - Intronic
1199505256 X:148554245-148554267 ATCAACCATATGCCAGGTGCTGG + Intronic
1199942571 X:152639849-152639871 CCCAGCCCTAGCCCAGGTAAGGG + Intronic
1201304403 Y:12538147-12538169 CCCAGCGAGATGCCAGGTATAGG + Intergenic