ID: 1146379027

View in Genome Browser
Species Human (GRCh38)
Location 17:32314882-32314904
Sequence CATGCTAGGAAGCAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146379027_1146379034 20 Left 1146379027 17:32314882-32314904 CCTGCCATCTGCTTCCTAGCATG 0: 1
1: 0
2: 1
3: 8
4: 191
Right 1146379034 17:32314925-32314947 ACAGGCTTTCCACCTAAAGCGGG 0: 1
1: 1
2: 0
3: 4
4: 93
1146379027_1146379032 2 Left 1146379027 17:32314882-32314904 CCTGCCATCTGCTTCCTAGCATG 0: 1
1: 0
2: 1
3: 8
4: 191
Right 1146379032 17:32314907-32314929 ACATGTCGGCAAGCGAAGACAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1146379027_1146379035 28 Left 1146379027 17:32314882-32314904 CCTGCCATCTGCTTCCTAGCATG 0: 1
1: 0
2: 1
3: 8
4: 191
Right 1146379035 17:32314933-32314955 TCCACCTAAAGCGGGACCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 18
1146379027_1146379033 19 Left 1146379027 17:32314882-32314904 CCTGCCATCTGCTTCCTAGCATG 0: 1
1: 0
2: 1
3: 8
4: 191
Right 1146379033 17:32314924-32314946 GACAGGCTTTCCACCTAAAGCGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146379027 Original CRISPR CATGCTAGGAAGCAGATGGC AGG (reversed) Intronic
901379708 1:8864851-8864873 CAGGAGAGGAAGCTGATGGCTGG - Intronic
905368892 1:37472117-37472139 CTGGCTAGGAAGCAGCTGGGTGG + Intergenic
905933001 1:41802958-41802980 AACCCTAGGAAGCAGCTGGCAGG + Intronic
906109004 1:43311243-43311265 CATGCTATGAAGCGTGTGGCGGG + Intronic
909070543 1:70988325-70988347 GATGCTAGGAAGCAATTGGAAGG - Intronic
910191718 1:84602064-84602086 CTTGTTAAGAAGCAGATTGCTGG - Intergenic
910758367 1:90713400-90713422 CCTGCTAGGAAGAAGAGAGCGGG + Intronic
911040501 1:93587555-93587577 CATGCTAGTCAGCATCTGGCTGG - Intronic
913028827 1:114875793-114875815 CATGCTATTAAGTAAATGGCTGG + Intronic
917656284 1:177129413-177129435 CAAGCAAGGAAGCAGGAGGCTGG + Intronic
922152418 1:223017438-223017460 CTGGCTAGGAAGCAGTTGCCTGG + Intergenic
922763220 1:228145054-228145076 CATGCATGGGAGCAAATGGCTGG + Intronic
1062980455 10:1718164-1718186 CATCATAGGAAGGTGATGGCCGG + Intronic
1063543767 10:6960688-6960710 CATCCTGGGAAGGAGATAGCAGG - Intergenic
1063564475 10:7161002-7161024 CGTGCCAGGGAGGAGATGGCTGG - Exonic
1065267391 10:23991850-23991872 CATGATAGGAAGTAGCTGGTTGG + Intronic
1065731093 10:28710375-28710397 CAGGCTGGGAGGCAGAAGGCTGG - Intergenic
1068276672 10:54808410-54808432 CATGCAAAGAAGCAGCTTGCTGG - Intronic
1070618462 10:77987816-77987838 CAAGCTGGGCAGCAGCTGGCTGG - Intronic
1070704706 10:78629231-78629253 CAGGCCAGCAAGCAGAAGGCAGG - Intergenic
1070834482 10:79439499-79439521 CACGCTAAGAACCAGATGCCAGG + Intronic
1071556778 10:86610338-86610360 CAGGAAAGGAAGCAGATGGTTGG - Intergenic
1072543959 10:96419905-96419927 ACTGCTAGGAAGCACAGGGCAGG + Intronic
1072573779 10:96681121-96681143 CCTGCTTGGTTGCAGATGGCTGG + Intronic
1075174344 10:120145240-120145262 TATGATATGAAGCAGCTGGCAGG + Intergenic
1075466538 10:122655671-122655693 CATGCTGGGATGCTGCTGGCGGG + Intergenic
1076369146 10:129940686-129940708 CCTGCTAGGAAGTAGGGGGCTGG + Intronic
1077107063 11:846757-846779 CCTGGTAGGAAGCAGACAGCAGG + Intronic
1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG + Intronic
1078991788 11:16655155-16655177 GATTCTAGGATGCAGATGGTAGG + Intronic
1080347067 11:31336856-31336878 CATTCTAGGTAGCAGAAGGAAGG - Intronic
1083863802 11:65442444-65442466 CAGGCTATGAAGGAAATGGCTGG + Intergenic
1084603526 11:70160154-70160176 CATGCAAGGGTGCAGAGGGCAGG - Intronic
1084606703 11:70176693-70176715 CATGACAGGAAGCAGGGGGCGGG - Intronic
1091092047 11:132780518-132780540 CATTTTTGAAAGCAGATGGCAGG + Intronic
1092137221 12:6158568-6158590 CAGGCCAGGAAGCAGACAGCGGG + Intergenic
1092265408 12:6976953-6976975 CATGCTAGGAAACATCTGGAAGG - Intronic
1096608203 12:52782657-52782679 CATGGTAGGTTGCACATGGCTGG - Intergenic
1096836237 12:54353106-54353128 CATGCTGGAAAACAGAAGGCAGG - Intergenic
1098180636 12:67842546-67842568 GATGACAGGAAGCAGATGGAAGG - Intergenic
1099974307 12:89530324-89530346 TATTCTAGGAGGCAGAAGGCAGG - Intergenic
1100265789 12:92974642-92974664 CAAGCTAGGGAACAAATGGCTGG + Intergenic
1102603720 12:114052891-114052913 CATTCCAGGATGGAGATGGCAGG + Intergenic
1103010873 12:117457283-117457305 CATGGAAGGTTGCAGATGGCAGG + Exonic
1104327542 12:127813396-127813418 CATGAAAGGGAGCAGAGGGCAGG + Intergenic
1106439368 13:29751865-29751887 CATACTAGAAAGGACATGGCAGG + Intergenic
1108285896 13:48907573-48907595 CATGCTAGGAAATTGAGGGCAGG - Intergenic
1108431259 13:50356256-50356278 AAGGCTAGAAAGCAGAAGGCTGG - Intronic
1108725845 13:53180313-53180335 CATTCAAGGAAACAGATAGCAGG - Intergenic
1110617234 13:77554682-77554704 CAACTTAGGAAGTAGATGGCAGG + Intronic
1111912460 13:94327934-94327956 CATGCTTGGATGAAGAAGGCAGG - Intronic
1112001403 13:95213168-95213190 CATGGTTGGAAGCAGAAGCCTGG - Intronic
1112700064 13:101997539-101997561 CATGCTTAAAAGCAGATTGCTGG + Intronic
1116168148 14:41361021-41361043 CATGATAGGAAGAAGATGTGAGG - Intergenic
1117798437 14:59418750-59418772 CACCCTAAGAAGCAGATGGTAGG + Intergenic
1118857273 14:69633415-69633437 CATGCTAGATAGCGGGTGGCAGG - Intronic
1120334974 14:83143083-83143105 CATGGTAGGAACCTGATGGGAGG - Intergenic
1121096434 14:91220893-91220915 AATGCCAGGAAGCTGATGCCTGG + Intronic
1121619347 14:95335423-95335445 CATCCACGGAAGCAGATGACAGG + Intergenic
1122843186 14:104476671-104476693 CATGCTGGGAGGCAGACGGTCGG + Intronic
1124634443 15:31355956-31355978 TCTGCCAAGAAGCAGATGGCAGG - Intronic
1125426472 15:39554161-39554183 CTTACTGGGAAGCAGATGGGTGG + Intergenic
1125749303 15:42018042-42018064 CATGCTGGGAGGAAGGTGGCAGG + Intronic
1126739802 15:51766033-51766055 TATGCTGGGAATCAGAAGGCGGG + Intronic
1132292712 15:100714464-100714486 CCTGGTAGGAAGGAGGTGGCAGG + Intergenic
1132696999 16:1206481-1206503 CATGCAGGGAGTCAGATGGCAGG + Intronic
1134193727 16:12142352-12142374 CATGCTTGTCAGCAGCTGGCTGG + Intronic
1136036048 16:27541292-27541314 CCAGCTAGGAAGCAGAAGGAAGG + Intronic
1138087606 16:54147492-54147514 CTTGCTCGGAGGGAGATGGCAGG - Intergenic
1140749469 16:78010166-78010188 CAGGCTAGGAGGAAGATGGCAGG - Intergenic
1141322545 16:83025549-83025571 CATGGGAGGAAGCCGATGGGAGG - Intronic
1142316528 16:89350342-89350364 CATGCAAAGCATCAGATGGCTGG - Intronic
1142804592 17:2364800-2364822 CTGGGTAGGAGGCAGATGGCTGG - Intronic
1142896773 17:2984910-2984932 CAAGTGAGGAAGCACATGGCAGG - Intronic
1143354802 17:6318640-6318662 GAAGCTAGGAAGCAGGTGGATGG + Intergenic
1143713699 17:8752465-8752487 CTTGCTATGAAGCAGATCACTGG - Intergenic
1145268030 17:21389825-21389847 AGGGCTAGGAAGCAGGTGGCTGG - Intronic
1146378887 17:32314109-32314131 CAAGCTAAGAAGCAGATGGCAGG - Intronic
1146379027 17:32314882-32314904 CATGCTAGGAAGCAGATGGCAGG - Intronic
1148026558 17:44593064-44593086 CAGGCTACGAAGCAGATGAGTGG - Intergenic
1148184641 17:45633297-45633319 CATTCTAGCAAGGAGATGGTGGG - Intergenic
1149754195 17:59174144-59174166 CTTGCTATGAAGCAGATCACTGG - Intronic
1151692394 17:75694603-75694625 TCTGCTGGGAAGCCGATGGCCGG + Intronic
1152791775 17:82283891-82283913 CATGCTTGGAAGCTGGGGGCGGG + Intergenic
1153812060 18:8760505-8760527 CCTGCTAGGAAGCAAATGTTAGG + Intronic
1155150769 18:23121288-23121310 CCCGCTGGGAAGCAGATGGATGG - Intergenic
1157320838 18:46632635-46632657 GATGCCAACAAGCAGATGGCAGG + Intronic
1157833110 18:50875652-50875674 CATACAAGGAAGCTGACGGCCGG - Intergenic
1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG + Intronic
1167272295 19:48512130-48512152 CACGCTAAGATGCAGATGTCAGG + Intronic
1167684096 19:50944677-50944699 CATGCTATGATGCACACGGCAGG - Intronic
1168061110 19:53892728-53892750 CATGCTGGGAGGCAGAGGGAAGG - Intronic
926713347 2:15901933-15901955 TATGCCTGGAAGCAGATTGCTGG - Intergenic
928890042 2:36193901-36193923 CTTGCTGGGAAGAAGCTGGCAGG + Intergenic
929901760 2:46010519-46010541 TATGTTAGGAAGAAGCTGGCTGG + Intronic
934771026 2:96907703-96907725 GAGGCTAGGAAGCAGAGCGCTGG - Intronic
936600501 2:113890265-113890287 CAGGCGAGGAGGAAGATGGCGGG + Exonic
936933191 2:117811427-117811449 CATTGTAGAAAGCAGATGGCTGG - Intergenic
937009156 2:118546188-118546210 AATGTTAGAAAGCAGGTGGCAGG - Intergenic
937572068 2:123376011-123376033 CTTGTTGGGAAGCAGATGGTAGG + Intergenic
940581445 2:155585012-155585034 CAAGCCAGGGAGCAGATGGGAGG - Intergenic
1169877316 20:10312222-10312244 AATGCTTTGAAGCAGATGGAAGG - Intergenic
1171005871 20:21465386-21465408 CATCCTGGGAAGAGGATGGCAGG - Intergenic
1173217015 20:41094499-41094521 CAAGATAGGAAGCAGAGGCCTGG + Intronic
1173400664 20:42723333-42723355 CCAGCTCGGAAGCAGCTGGCAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175307875 20:57989942-57989964 CATGGTATGAAGCAGGTGGGAGG + Intergenic
1179462505 21:41547203-41547225 CATGCTGGGAGGCTGCTGGCAGG + Intergenic
1181397274 22:22631263-22631285 CTTGCTTGGAAGCAGTAGGCTGG + Intergenic
1181705243 22:24645938-24645960 CTTGCTTGGAAGCAGTAGGCTGG + Intergenic
1181928383 22:26378722-26378744 CATGCGAGGAAGCAAAAGGCTGG + Intronic
1182375671 22:29845876-29845898 CATGCTAAGGAGCTGATGGTGGG + Intergenic
1184381439 22:44147265-44147287 CATGATAAGAAGCAGTTGGAGGG + Intronic
1184818221 22:46888487-46888509 CATGGTACCAACCAGATGGCGGG - Intronic
950201648 3:11048628-11048650 CATGGTAGGAGGCAGTTGGAGGG - Intergenic
954869794 3:53759071-53759093 TAATCTAGGAAGCAGAAGGCAGG - Intronic
960697302 3:120408600-120408622 CATGTGAGGGAGTAGATGGCTGG + Intronic
961875461 3:130019619-130019641 GATGCTAGGAAGCAAAGGGGTGG - Intergenic
961997496 3:131261416-131261438 AATGCTAAGAAGCAAATGGCTGG - Intronic
963040967 3:141069535-141069557 CATCCTTGGAAGCAAAAGGCAGG + Intronic
963466388 3:145687429-145687451 CCTGACAGGAAGTAGATGGCAGG + Intergenic
965672407 3:171160162-171160184 CATGCTATGTATCAGATGGTAGG + Intronic
966407984 3:179619009-179619031 CCAGCTGGGAAGCAGATGGATGG + Intronic
967182172 3:186915428-186915450 CATGCTAGAAAGCAGGAGGTGGG - Intergenic
967743138 3:193024852-193024874 AGAGCTAGGAAGCAGATGACAGG + Intergenic
967856828 3:194124314-194124336 ACTGCTGGGAAGCAGATGGAAGG - Intergenic
968947691 4:3674286-3674308 CATTCTAGGGAGGAGATAGCCGG - Intergenic
972102380 4:35437989-35438011 CATGCAAGGAAACAGCTGGCAGG - Intergenic
982642471 4:157980359-157980381 CATAATAGCAAGCAAATGGCTGG - Intergenic
982724309 4:158889362-158889384 CATACTAGGAAGGTGATGGATGG - Intronic
983295949 4:165869541-165869563 CAAGCTAGGAAGTAGAGAGCTGG + Intergenic
985700864 5:1371487-1371509 CATGCAAGGAGGCACGTGGCCGG + Intergenic
985913855 5:2903131-2903153 CAGGGCAGAAAGCAGATGGCAGG - Intergenic
986393281 5:7304316-7304338 CAGGCCAGGAAGCAGTAGGCAGG + Intergenic
986578126 5:9233827-9233849 CATGCATGGAAGGAGGTGGCTGG - Intronic
989243776 5:39230236-39230258 TATACATGGAAGCAGATGGCAGG + Intronic
990502682 5:56412398-56412420 CATGGTAGGAATCAGTTGTCTGG - Intergenic
993436443 5:87901395-87901417 CATACTAGAAAGGAAATGGCAGG + Intergenic
994050787 5:95359736-95359758 CTTGTTAGAATGCAGATGGCTGG - Intergenic
997748173 5:136318095-136318117 CCTGCGAGGAAGAAGATGACAGG + Intronic
998603151 5:143605434-143605456 CATTCTAGAAATCAGTTGGCGGG + Intergenic
998673550 5:144381469-144381491 CAGGCTTGGAAGCATAGGGCTGG + Intronic
999726717 5:154444732-154444754 CATGTTTAGAAGCAGGTGGCTGG - Intergenic
1000819047 5:165960698-165960720 CATGCCAGGAAGCACAGGCCGGG - Intergenic
1001798034 5:174518602-174518624 CAAGCTAGGAAGCTGCTGGAGGG - Intergenic
1003155743 6:3592556-3592578 CATGGCAGGAAGCAGAGTGCTGG - Intergenic
1007117992 6:39357305-39357327 CATGCTGGGAGTCAGATGTCTGG + Exonic
1007862997 6:44934004-44934026 TATAGTAGGTAGCAGATGGCAGG + Intronic
1012939752 6:105403494-105403516 CAGCCTTGGAAGCAGAGGGCTGG + Intergenic
1013240781 6:108243683-108243705 CATTTTAGGAAGCCGAGGGCGGG + Intronic
1019858731 7:3636513-3636535 CATGCTATGTAGCAAATGCCAGG + Intronic
1020044468 7:5030933-5030955 CTTGCTATGAAGCAGATCACTGG - Intronic
1023825879 7:44008421-44008443 CTTGCTATGAAGCAGATCACTGG + Intronic
1024671809 7:51602542-51602564 CATGCTGGGAGGCAGCTGTCAGG - Intergenic
1026071741 7:67127871-67127893 CATGCAAGCAAGGAGACGGCAGG - Intronic
1026089451 7:67287272-67287294 CTTGCTATGAAGCAGATCACTGG + Intergenic
1026705162 7:72684395-72684417 CATGCAAGCAAGGAGACGGCAGG + Intronic
1026853509 7:73738768-73738790 CATGCTTGCAAGCTGTTGGCCGG + Exonic
1027033065 7:74905995-74906017 CTTGCTATGAAGCAGATCACTGG - Intergenic
1027119046 7:75502590-75502612 CTTGCTATGAAGCAGATCACTGG + Intergenic
1027272780 7:76533018-76533040 CTTGCTATGAAGCAGATCACTGG - Intergenic
1027326229 7:77052103-77052125 CTTGCTATGAAGCAGATCACTGG - Intergenic
1027873159 7:83735764-83735786 CATGCTAGAACACAGATTGCTGG + Intergenic
1028174421 7:87637096-87637118 CATGGGAGGGAGCAGATGGGAGG - Intronic
1028264828 7:88710061-88710083 GATGCTGGGAAGCAGAAAGCAGG - Intergenic
1028907598 7:96172656-96172678 CATGCAATAGAGCAGATGGCTGG - Intronic
1029754164 7:102561828-102561850 CTTGCTATGAAGCAGATCACTGG + Intronic
1029772114 7:102660918-102660940 CTTGCTATGAAGCAGATCACTGG + Intronic
1033150091 7:138906876-138906898 CATGCTGGGGAGGTGATGGCGGG - Intronic
1035118000 7:156540921-156540943 CAGGCCAGGAAGCAGGTGGCAGG + Intergenic
1035486986 7:159233686-159233708 CATGCTGGGAATGGGATGGCTGG + Intergenic
1036910235 8:12752992-12753014 AAAGCGAGGAAGCAGATGCCAGG - Intronic
1037690437 8:21177197-21177219 CATAGGAGGAAGCAGTTGGCTGG - Intergenic
1037768612 8:21786451-21786473 CATGCTTGGACCCAGAAGGCTGG + Intronic
1038492327 8:27980230-27980252 CAAGCAAGGAAGCAGAGGCCAGG + Intronic
1044233038 8:89800960-89800982 CATTTTAGGAAGCAGATAGAAGG - Intergenic
1045244990 8:100435062-100435084 CTTGTTAAAAAGCAGATGGCTGG + Intergenic
1047026081 8:120826047-120826069 CATGCTATGAAGCAGAAGGAAGG - Intergenic
1047409219 8:124610683-124610705 CATGCCAGGAGGAAGATGGTAGG + Intronic
1047776726 8:128077384-128077406 CAGGTTAGGAAGCAGATGCTAGG - Intergenic
1049600542 8:143505451-143505473 CATGCTGGGACGCAGGTGGCAGG + Intronic
1050033799 9:1413928-1413950 CAACCAAGGAAGCAGAAGGCTGG + Intergenic
1052165742 9:25325645-25325667 AACACTAGGAAGCAGATGACAGG + Intergenic
1053476298 9:38384413-38384435 CATTCTAGGGATCAGAAGGCGGG - Intergenic
1055166907 9:73207844-73207866 CATGCTAGGAACCAGGTAGAAGG - Intergenic
1057947941 9:99345930-99345952 CATGCTAGGAACTAGATAGAAGG - Intergenic
1058347165 9:103978125-103978147 CATCCTGGCAAGCAAATGGCTGG - Intergenic
1058456641 9:105143725-105143747 CATGAGAGGAAGCCGATGGAAGG - Intergenic
1060345033 9:122808502-122808524 CATGCTAGGATGCAGCTAGAAGG - Intronic
1060401665 9:123353246-123353268 CTTTCCAGGAAGCAGATGGAAGG + Intergenic
1060479320 9:124008812-124008834 TCTGCGAGGAAGCAGATGGTGGG + Intronic
1060730569 9:126034251-126034273 CCTGGCAGGAAGCTGATGGCAGG + Intergenic
1186198900 X:7136711-7136733 CATGCCAGGATGCAGTGGGCGGG - Intronic
1187243913 X:17537436-17537458 CAGGCTAGGAAGCATATTACTGG - Intronic
1192370402 X:70508252-70508274 CATGCTTGGAAGGTAATGGCTGG - Intergenic
1195065773 X:101236958-101236980 CATGGTAGGAAGCTGGAGGCTGG - Intronic
1195701835 X:107711582-107711604 CATGCCATGAACCAGTTGGCAGG + Intergenic
1195735166 X:108005176-108005198 CAAGAGAGGAAGCAGATGGAGGG - Intergenic
1198389819 X:136162671-136162693 CTTGTTAGGACACAGATGGCGGG - Intronic
1200795714 Y:7339477-7339499 CAGGCTAGGAAGCATGTGTCAGG + Intergenic
1201239289 Y:11942915-11942937 AAAGCTTGGAGGCAGATGGCAGG - Intergenic