ID: 1146384811

View in Genome Browser
Species Human (GRCh38)
Location 17:32360678-32360700
Sequence CAGCCTGTTCAACCTCAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146384809_1146384811 -3 Left 1146384809 17:32360658-32360680 CCTCAACTTCATTTCAGCCACAG 0: 1
1: 1
2: 2
3: 17
4: 248
Right 1146384811 17:32360678-32360700 CAGCCTGTTCAACCTCAGCAAGG 0: 1
1: 0
2: 1
3: 26
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146384811 Original CRISPR CAGCCTGTTCAACCTCAGCA AGG Exonic
904147602 1:28406368-28406390 CAGACTGTTCAAACTAAGGATGG + Intronic
905063568 1:35160442-35160464 CTGCCTGTCCAACCTCAGCCAGG + Intergenic
909621359 1:77671073-77671095 CTGCCGGTCCAACCTCAGAATGG + Intronic
909769731 1:79406111-79406133 CACTTTGTTCAACCTCAGCTGGG - Intergenic
910238978 1:85065515-85065537 CTGCCTGTCCAACCTCAGACTGG - Intronic
910403506 1:86860239-86860261 CACCTTGTTCGACCTCAGCTGGG + Intergenic
910687711 1:89934637-89934659 CAGTCTGTTCAACTTTTGCAGGG - Exonic
915123878 1:153649801-153649823 AAGGCAGTTCAACCTAAGCATGG + Intergenic
915437731 1:155921505-155921527 CAGCCAGTTCAACCTCCCTACGG - Exonic
915513621 1:156400572-156400594 CAGCCTGGCCAACCTCAGAGAGG - Intergenic
919691669 1:200533300-200533322 CAGCCTGGGCAAAATCAGCAAGG + Intergenic
920364237 1:205439715-205439737 AAGCCTGTTCTCCCTCATCAGGG - Intronic
922045960 1:221946435-221946457 AAACCAGTTCAACCACAGCAGGG - Intergenic
922241392 1:223757517-223757539 GAGCCTGGGCAACTTCAGCAGGG - Intronic
922633828 1:227143411-227143433 TCTCCTGTTCAACCTCAGCTGGG - Intronic
922859186 1:228801293-228801315 CACCTTGTTCCACCTCAGCTAGG + Intergenic
1064205804 10:13322618-13322640 CAGGCCACTCAACCTCAGCAAGG + Intronic
1065251623 10:23821365-23821387 CAGCCTGTGCCACCTGAACATGG - Intronic
1068489410 10:57704009-57704031 CAGCTTGCTCAACCTCATCTGGG - Intergenic
1072542864 10:96411721-96411743 CATGCAGTTCAACCTCTGCATGG + Intronic
1074227686 10:111503137-111503159 CACCTTGTTCAATCTCAGCTGGG - Intergenic
1076730035 10:132433847-132433869 CACCCAGTGCACCCTCAGCATGG - Intergenic
1080026727 11:27622943-27622965 CAGGCTGTTCAGCCTTTGCATGG - Intergenic
1081555789 11:44159824-44159846 CATCCTGTCCCACCTAAGCAAGG - Intronic
1082240104 11:49860327-49860349 CAGACTGTACAACCACAACATGG + Intergenic
1083773816 11:64883431-64883453 CAGCCTCATCAGCCCCAGCAAGG - Intronic
1083942430 11:65903577-65903599 CACCCTGTGCATTCTCAGCATGG + Intergenic
1085469004 11:76744859-76744881 CAGCCTGTTCCCAGTCAGCAGGG + Intergenic
1085609627 11:77935037-77935059 CAGCCTCTTCATTATCAGCAAGG - Intronic
1085702055 11:78754446-78754468 CAGCCTGATCAATGCCAGCAGGG - Intronic
1086147355 11:83567173-83567195 CAGCATTCTCAACCTCAGAAGGG + Intronic
1086754444 11:90542123-90542145 CACCTTGTTCAACCTTAGCTGGG - Intergenic
1087216518 11:95501235-95501257 CAGCATGTTCACCCTCATTATGG - Intergenic
1087366457 11:97225927-97225949 CAGCCAGTTCATGCTCCGCAAGG - Intergenic
1089253683 11:117182326-117182348 CATTCCCTTCAACCTCAGCAGGG - Intronic
1089801470 11:121032790-121032812 CACCTTGTTCTACCTCAGCAGGG + Intronic
1090351984 11:126113659-126113681 CTGCCTGTACAACCTCAGTGAGG + Intergenic
1090856977 11:130618402-130618424 CAGCCTGTGAGACCTGAGCAAGG + Intergenic
1091180658 11:133601475-133601497 AAGCCTTTACCACCTCAGCATGG - Intergenic
1092996953 12:13959581-13959603 CAGCCGGTTCTCCCTCCGCATGG - Intronic
1099854930 12:88152000-88152022 AAGCCTGTTCATCCTTAGTAGGG - Intronic
1103748728 12:123144122-123144144 CCCCTCGTTCAACCTCAGCAGGG - Intronic
1103932294 12:124457265-124457287 CAGCATGCTGATCCTCAGCACGG + Intronic
1105580422 13:21690718-21690740 CATCTTCTTCAACCTCAGCTGGG - Intronic
1105970248 13:25422830-25422852 CAGCCTGTGCAACCTCAGACAGG - Intronic
1107670352 13:42739907-42739929 CATCCTGTTCATCCTCTACAGGG + Intergenic
1107840118 13:44449164-44449186 CAGCCTGCCCAGCCTCAGAAAGG - Intronic
1109451444 13:62519860-62519882 CAACCTGTCCCACCTTAGCAAGG + Intergenic
1109944037 13:69408293-69408315 CATCTTGGTAAACCTCAGCATGG + Intergenic
1110512237 13:76364459-76364481 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1111153276 13:84288128-84288150 CACATTGTTCAACCTCAGCTGGG - Intergenic
1112777722 13:102863710-102863732 CACCTTGCTTAACCTCAGCAGGG - Intronic
1116040740 14:39683721-39683743 CTTCCTATTCAACCACAGCAAGG - Intergenic
1116811033 14:49540471-49540493 CATTCTGTCCAACCTCAGAAAGG + Intergenic
1117256306 14:53981376-53981398 CAGCCTGTTCATCCTCCCCTGGG - Intergenic
1118508087 14:66437934-66437956 CATCTTGTTCAACATCAGCAGGG + Intergenic
1120744503 14:88141571-88141593 CAGCCTGTGCATCCTCAGGGTGG + Intergenic
1121255854 14:92529623-92529645 CGCCCTGTTCAACCTCAGCTGGG - Intronic
1121497907 14:94409699-94409721 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1122262103 14:100529528-100529550 CAGCCCCTTCCACCCCAGCAAGG - Intronic
1122596391 14:102895908-102895930 CAGCCTGCTCACCCTCAACACGG - Intronic
1122624753 14:103078842-103078864 CAGCCTGTTCAAGCTTTGGAAGG + Intergenic
1122723084 14:103732864-103732886 CAACCTGTTCCCCCTCAGCTGGG + Intronic
1124314396 15:28655498-28655520 CACCCTGCGCCACCTCAGCATGG - Intergenic
1124589640 15:31041542-31041564 CATCCTGTCCCACCTAAGCATGG + Intronic
1126830287 15:52595913-52595935 AAGCCTGTGCAAACACAGCAGGG + Intronic
1127818775 15:62637072-62637094 CAGCCTATACAATCTCAGGAAGG - Intronic
1128368004 15:67018375-67018397 CAGTCCTTTCAAACTCAGCAAGG + Intergenic
1128468255 15:67930554-67930576 CAGCTTGTTCCCCATCAGCAGGG - Intergenic
1128665938 15:69538568-69538590 CCCTCTGTTCACCCTCAGCAGGG + Intergenic
1129255568 15:74332180-74332202 CTGCCTGTGCAACCTCACCCAGG + Intronic
1129470827 15:75752433-75752455 CAGCCTCTTCCACCTCCCCAAGG - Intergenic
1133503187 16:6385118-6385140 AACCATGTTCAGCCTCAGCATGG + Intronic
1133610336 16:7427400-7427422 AAGCCTGTCCAACTTCAGCAGGG - Intronic
1135205556 16:20480867-20480889 CAGCCGTCTCAACCACAGCAGGG - Exonic
1135213351 16:20542946-20542968 CAGCCGTCTCAACCACAGCAGGG + Exonic
1135868760 16:26129327-26129349 CAAACTGTAAAACCTCAGCAAGG - Intronic
1137276975 16:46941625-46941647 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1138737848 16:59272624-59272646 CACCTTGTTCAAGCTCAGCTGGG - Intergenic
1139775881 16:69316858-69316880 CATCCTGTGCCACCTCGGCAGGG - Intronic
1141189093 16:81810533-81810555 CATCTTGTTTGACCTCAGCAGGG - Intronic
1141423623 16:83932158-83932180 CAGCCTGTCCCACCACAGAACGG + Intronic
1142195269 16:88736674-88736696 CAGCCTGGGCCACCTCATCATGG - Exonic
1143811060 17:9472243-9472265 CACCTTGTTCAACCTCGGCTGGG + Intronic
1144188121 17:12815402-12815424 CAGCCTTTTCTACCCCACCAAGG - Intronic
1144247098 17:13377691-13377713 AAGCTTGTTCAACATCAGCCAGG - Intergenic
1146384811 17:32360678-32360700 CAGCCTGTTCAACCTCAGCAAGG + Exonic
1147456770 17:40542748-40542770 CAGTCTGTGCAACGTCAGCCTGG - Intergenic
1147912156 17:43862174-43862196 CAGGCTGCTGACCCTCAGCAGGG + Exonic
1149640763 17:58201093-58201115 CCCCCTGTTCAACCCCAGTAGGG + Intronic
1149909944 17:60557934-60557956 ATGCCTGTACAACATCAGCAGGG + Intergenic
1151517206 17:74604308-74604330 CAGCCTGTTGCAGCTCATCAGGG - Intergenic
1151805222 17:76400790-76400812 CAGCCTGTACAGGCTGAGCAAGG - Intronic
1151849335 17:76681128-76681150 GACCCTGTTCAGCCTCTGCAGGG + Intronic
1151880820 17:76893443-76893465 CAGCCGGTTCAAGCTCACCTGGG + Intronic
1155051694 18:22153564-22153586 AGTCCTGTTCAACCTCAGCTGGG - Intergenic
1155729324 18:29132939-29132961 CACCTTGCTCAACCTCAGCTGGG - Intergenic
1157375269 18:47158367-47158389 CAGCCTGGGCAACTCCAGCAGGG - Intronic
1157782845 18:50455464-50455486 CTGCCTGTTCAACATCAGACTGG + Intergenic
1157859327 18:51126300-51126322 CAGTCTCTTCAAGGTCAGCAAGG + Intergenic
1158587087 18:58749513-58749535 CATCTTGTTCAGCCTCAGCTGGG + Exonic
1159958713 18:74539080-74539102 CAGCCTGTTAAAGCTAAACAGGG + Intronic
1162439144 19:10682026-10682048 CAGCTGGTTCAACCGCATCAGGG - Exonic
1163656210 19:18546594-18546616 CAGCCTGGGCAACCTAAGCCTGG + Intergenic
1164674900 19:30094548-30094570 CAGCCTTTCCACCTTCAGCAAGG - Intergenic
1165200795 19:34142784-34142806 CAACCTGCTCAACCCCACCATGG + Intergenic
1166198388 19:41220811-41220833 CATCCTGTTCATCCTCACCCAGG - Exonic
1166775834 19:45311949-45311971 CAGCCTGTCCCACCTCAACCAGG + Intronic
1166856687 19:45785842-45785864 CAGCCTGGGCAACATCAGCCGGG - Exonic
1167188435 19:47964931-47964953 CACCTTGTTCAACCTCAGCAGGG - Intergenic
1167900076 19:52614512-52614534 CAGCCTGTTAAAAATCAGCTTGG - Exonic
1168526890 19:57095756-57095778 CACCCTGGAAAACCTCAGCAGGG - Intergenic
925116241 2:1380647-1380669 GAGCCTGTTCTAACTCAGCTGGG - Intronic
926402636 2:12513762-12513784 CAGCCTGTGTAACCTCATGAGGG + Intergenic
931097985 2:58963515-58963537 CAACCTCTGCAACCTCAGCGGGG + Intergenic
931483553 2:62667867-62667889 CACCTTGTTTAACCTCAGCTGGG - Intergenic
932485823 2:72083844-72083866 CAGCCTGTTCCAGCTCAGGCTGG - Intergenic
936082489 2:109443393-109443415 CGCCTTGTTCAACCTCAGCTGGG + Intronic
936473608 2:112820530-112820552 CTGCCTGTCCAACCTCAGACTGG - Intergenic
937760250 2:125592128-125592150 TGCCTTGTTCAACCTCAGCAGGG + Intergenic
937839300 2:126509720-126509742 CAGCCTTTCCCACTTCAGCAGGG - Intergenic
940608051 2:155953089-155953111 CAGCCTGATCATCCTGGGCATGG - Intergenic
941160331 2:162027923-162027945 CACCCTGTGCATGCTCAGCAAGG + Intronic
941668962 2:168270458-168270480 CACTCTCTTGAACCTCAGCATGG - Intergenic
944842284 2:203635609-203635631 CAACCTGTTCAACTTCAACAAGG - Intergenic
946556143 2:220859861-220859883 CTGCCTGTCCAACCTCAGACTGG - Intergenic
948198295 2:236111450-236111472 CAGCCTGCTCAAACCCAGCCTGG + Intronic
948544307 2:238716146-238716168 CTGCCTGTGCAACCTCAGACTGG - Intergenic
1169036660 20:2458654-2458676 CTGCTTGTTCAACCTCAGACTGG + Intergenic
1169155962 20:3329897-3329919 CTGGCTGTGCAACCTCAGAAAGG - Intronic
1169325871 20:4676042-4676064 CTGCCTGTCCAACCTCAGACTGG + Intergenic
1171431388 20:25085014-25085036 CAGCAGGTCCAACCTCAGCCTGG - Intergenic
1172648873 20:36489159-36489181 CACCTTGTTCCACCTCAGCTGGG + Intronic
1174308613 20:49632784-49632806 CAGCCCGTTCACCTGCAGCACGG + Intergenic
1175213526 20:57376681-57376703 CAGCCTGTCCACCCCCAGCCAGG - Intronic
1175475244 20:59268526-59268548 CAGCCTGTTCTTCCTCAAGACGG - Intergenic
1177280214 21:18972452-18972474 CAGCCATTTCAGCCTCAGCTTGG - Intergenic
1178072147 21:28980062-28980084 CGCCTTGTTCAACCTCAGCTGGG - Intronic
1179647118 21:42782853-42782875 CAACCTGTTCAATGTCACCAGGG + Intergenic
1179776982 21:43671145-43671167 GAGCCTGCTGCACCTCAGCAGGG + Intronic
1179934276 21:44592481-44592503 CCACCAGTTCAACCCCAGCATGG - Exonic
1181916989 22:26289420-26289442 GAGGCTGCTGAACCTCAGCAAGG + Intronic
1183220796 22:36511683-36511705 CAGCCAGATCAACCTGAGCGTGG - Exonic
949320267 3:2802301-2802323 CACTTTGTTCAACCTCAGCTGGG - Intronic
949549752 3:5103079-5103101 CTGCCTGTCCAACCTCAGACTGG - Intergenic
950287508 3:11756525-11756547 CTGGCTGTTTAATCTCAGCAAGG - Intergenic
951615907 3:24543715-24543737 CTGCCTGTCCAACCTCAGACTGG - Intergenic
955844207 3:63143811-63143833 CCGCCTGTTCAACCTCAGACTGG + Intergenic
958982120 3:100733999-100734021 CTGCCTGTCCAACCTCAGACTGG - Intronic
959001826 3:100972939-100972961 CACCTTGTTCAACCTCAGCCAGG - Intronic
959116745 3:102187493-102187515 TGCCCTGTTCAACCTCAGCTGGG + Intronic
960798953 3:121518432-121518454 TGGCTTGTTCAACCACAGCAGGG + Intronic
960803433 3:121561062-121561084 CTGCCTGTCCAACCTCAGACTGG + Intergenic
962360251 3:134735575-134735597 CACCTTGTTCAACTTCAGCTGGG + Intronic
963538560 3:146559068-146559090 CTGCCTGTCCAACCTCAGAATGG + Intergenic
963946227 3:151148524-151148546 CAGGCTGTTCACACTCAGAAGGG + Intronic
964364581 3:155935597-155935619 CACCTTGTTCAAACTCAGCTGGG - Intronic
964504978 3:157389442-157389464 CACTTTGTTCAACCTCAGCTGGG + Intronic
965746556 3:171932440-171932462 CAGCCAGTTCTGCTTCAGCACGG + Intronic
971259445 4:25043104-25043126 CAGCCTGTTCCTTCTCAGCCAGG - Intergenic
976430607 4:84959697-84959719 CAGGCATGTCAACCTCAGCATGG - Intronic
977591606 4:98833619-98833641 CAGCCTTTGCATGCTCAGCAAGG - Intergenic
978181440 4:105801160-105801182 CATCTTGTTCCACCTCAGCTAGG + Intronic
980400996 4:132285575-132285597 TAGCCTGTTCAAAATCAGAAGGG + Intergenic
981579466 4:146237401-146237423 CAGGCTGTTTAACCTCATCAGGG + Intergenic
984148913 4:176101226-176101248 CATCCTGTCCCACCTAAGCAGGG + Intronic
985734943 5:1574092-1574114 CTCCCTGTTCACCATCAGCAAGG + Intergenic
985853927 5:2410558-2410580 CAGCCTCTGGAACCTCTGCAGGG - Intergenic
986213113 5:5692651-5692673 CTGCCTGTCCAACCTCAGACTGG + Intergenic
990441596 5:55851547-55851569 CAGCTTGTTCCACCTCAGCTGGG + Exonic
990593707 5:57292543-57292565 CAGCCTGGTGATCCACAGCAAGG - Intergenic
990660564 5:58009748-58009770 CATCTTGTTCAACCTCAGCTGGG - Intergenic
994349873 5:98732946-98732968 CACCTTGTTCAACCTCAGCTGGG - Intergenic
995797034 5:115952283-115952305 CTGCCTGTCCAACCTCAGACTGG + Intergenic
996636541 5:125696283-125696305 CAGCCTTTTCAACCTATGTATGG + Intergenic
996710022 5:126534945-126534967 AAGCCTCTTCTAGCTCAGCATGG - Intergenic
999962529 5:156772167-156772189 AAGCCTCCTCAACCTCACCAAGG - Intergenic
1000246642 5:159453841-159453863 CTGCCTGTTCTAGCTTAGCAGGG - Intergenic
1000370060 5:160526837-160526859 GAGCCTGTACAGCATCAGCAGGG - Intergenic
1001088812 5:168721834-168721856 CAGCATGGTGAACCTCTGCATGG - Intronic
1001350414 5:170957545-170957567 CACCTTGTTCAACCTCAGTTGGG - Intronic
1001748521 5:174110404-174110426 CAGCCTGTGCAGCCCCAGCTGGG - Intronic
1002564293 5:180101204-180101226 CAGTCTGTCCATCCTCGGCAAGG - Exonic
1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG + Intergenic
1003354664 6:5356021-5356043 CACCGTGTTCAACCTCAGCTGGG - Intronic
1003375709 6:5575254-5575276 CACCTTGTTCAACATCAGCTGGG + Intronic
1003883539 6:10500034-10500056 CATCTTGTTCAACCTTAGCTGGG - Intronic
1007101989 6:39255352-39255374 CGCCTTGTTCAACCTCAGCTGGG + Intergenic
1007749752 6:44064644-44064666 CTGCCTGTGCAGCCTCATCATGG - Intergenic
1007753338 6:44083200-44083222 GACCCTGTTCAACCTCAGGAAGG + Intergenic
1011440733 6:87384332-87384354 CTGCCTGTCCAACCTCAGGCTGG - Intronic
1013013382 6:106140053-106140075 CACCTTGTTCAACCTCAGCTGGG - Intergenic
1013087791 6:106871327-106871349 CTGCCAGTTCAACCTAAGCCTGG + Intergenic
1014850488 6:126334754-126334776 CTGCCTGTCCAACCTCAGACTGG + Intergenic
1015848970 6:137552109-137552131 CAGGCTCTGCAACCTCAGCCAGG + Intergenic
1016676151 6:146771145-146771167 CCGCCTGTGCAACCACAACAAGG - Intronic
1016899602 6:149088572-149088594 CAGCTTGTTCACCCTCAGCCTGG - Intergenic
1019951144 7:4373690-4373712 CACCTTGTTCAACCTCAGTGAGG - Intergenic
1020839244 7:13194783-13194805 CAGCCTATTCAAAGTAAGCAGGG - Intergenic
1021155393 7:17203598-17203620 CCGCCTGTTCAACTTCATCCCGG - Intergenic
1022285173 7:28949774-28949796 CACCTTGTTCAGCCTCAGCTGGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023440011 7:40175813-40175835 CACCTTGTTCAACCTCAGCTGGG + Intronic
1024158646 7:46651691-46651713 AACCCTTATCAACCTCAGCAGGG - Intergenic
1025843479 7:65173931-65173953 CAGCCTCTTCATTATCAGCAAGG + Intergenic
1025879566 7:65522036-65522058 CAGCCTCTTCATTATCAGCAAGG - Intergenic
1025893872 7:65680552-65680574 CAGCCTCTTCATTATCAGCAAGG + Intergenic
1027262985 7:76478274-76478296 CAGACTGTACTACCCCAGCAAGG + Intronic
1027314369 7:76976375-76976397 CAGACTGTACTACCCCAGCAAGG + Intergenic
1027929069 7:84507707-84507729 CACCTTGTTCAGCCTCAGCTGGG - Intergenic
1033034991 7:137866717-137866739 CACCTTGTTCAACCTCAGCTGGG + Intergenic
1033880311 7:145873499-145873521 CTGCCTGTCCAACCTCAGATTGG + Intergenic
1035452062 7:158983715-158983737 CAGCCTGTGAAAGCTCAGGAGGG - Intergenic
1036179970 8:6576143-6576165 CTTCTTGTTCAACCTCAGGAGGG + Intronic
1036418001 8:8568247-8568269 CACCTTGTTCAGCCTCAGCTGGG + Intergenic
1037168836 8:15865198-15865220 CAGCCTGGCCAACATCAGCCAGG - Intergenic
1037872955 8:22516635-22516657 CATTTTGTTCAACCTCAGCTAGG - Intronic
1039394606 8:37214620-37214642 CACCCTGTTCAACTTCCCCAGGG - Intergenic
1039771412 8:40691471-40691493 CACCGTGTTCAACCTCAGCTGGG + Intronic
1039895695 8:41715070-41715092 CAGCCTGTTTCTCCTCAGAAAGG - Exonic
1040754926 8:50761444-50761466 CATCCTGTCCAACCTAAGCGGGG - Intronic
1040951167 8:52940123-52940145 CAACCTGTTCATCCTCAACCTGG + Exonic
1040959414 8:53015348-53015370 CTGCCTGTCCAACCTCAGACTGG + Intergenic
1042523562 8:69741031-69741053 CACCTTGTTCCACCTCAGCTGGG - Intronic
1042834217 8:73063439-73063461 CAGGCTGTTGACCCGCAGCATGG + Intergenic
1043611589 8:82069799-82069821 CAACTTGTTCAATCTCAGCTGGG + Intergenic
1044542275 8:93421114-93421136 CAGCCTGATTACCCTCATCATGG + Intergenic
1044775726 8:95685579-95685601 CTGCCTGTACAGCATCAGCAGGG + Intergenic
1045033288 8:98157773-98157795 CAGCCTGTCCCTGCTCAGCAAGG + Exonic
1046989763 8:120439149-120439171 CACCTTGTTCAGCCTCAGCTGGG - Intronic
1047390423 8:124446259-124446281 CAGCCTGGGCAACTTGAGCAAGG - Intergenic
1047932646 8:129746050-129746072 CACCATGCTCATCCTCAGCATGG - Intergenic
1048468518 8:134686997-134687019 CAGCATCTTCAACCAAAGCAAGG + Intronic
1048786807 8:138059297-138059319 CAGCCTGTGCATCCTAAGGACGG + Intergenic
1049427044 8:142542359-142542381 CCGCCTCATCCACCTCAGCACGG + Exonic
1049963952 9:761842-761864 CAGCCTGCTGGAACTCAGCAAGG - Intergenic
1051382029 9:16468753-16468775 AAGCCTCTTAAACCTCAGCTTGG - Intronic
1053032223 9:34790240-34790262 CTGCCTGTTCAACCTCAGACTGG - Intergenic
1053218694 9:36293715-36293737 AAACCTGTTCAACATCAGCAGGG + Intronic
1054830258 9:69617085-69617107 CTGCCTGTCCAACCTCAGACTGG + Intronic
1054852157 9:69858327-69858349 CACCCTGTTCGACCTCAGTTGGG - Intronic
1057078797 9:92156393-92156415 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1057276868 9:93680730-93680752 CAGCCTGGGCAGCCCCAGCATGG - Intergenic
1057815990 9:98295224-98295246 CACCTTGCTCAACCTCAGCTGGG - Intronic
1058154483 9:101499590-101499612 CTGCCTGTCCAACCTCAAAATGG - Intronic
1059180438 9:112207304-112207326 CACCTTGTTCAGCCTCAGCTGGG - Intergenic
1059246580 9:112854730-112854752 CAGCCTGTCCAAGTCCAGCACGG + Intronic
1060823489 9:126674421-126674443 CTGCCTGTTCACACTTAGCAGGG - Intronic
1060998165 9:127886570-127886592 CAGCCTGTGGGACCTCAGGAGGG - Exonic
1061446492 9:130641142-130641164 CCGCCTTTTCCACCTCAGCTGGG - Intergenic
1061889593 9:133610838-133610860 CAGCCTGGAGAAACTCAGCAGGG - Intergenic
1062444471 9:136587894-136587916 CAGCATCTCCAGCCTCAGCAGGG + Intergenic
1203792487 EBV:159306-159328 CAGCCTGTACACCTTCATCACGG - Intergenic
1186940585 X:14502973-14502995 CACCTTGTTCAACCTCAGCTGGG + Intergenic
1187386603 X:18854552-18854574 CACCTTGTTCCACCTCAGCTGGG - Intergenic
1188942561 X:36258733-36258755 CAGGCTGTAGAACCTCAGCCAGG + Intronic
1189125753 X:38444203-38444225 CACCTTGTTCAACCTAAGCAAGG + Intronic
1190020634 X:46870676-46870698 CACCTTGTTCAGCCTCAGCTGGG + Intronic
1190419609 X:50216147-50216169 CAGCCTGACCAACATCAACATGG - Intronic
1192494954 X:71610023-71610045 CAGCCTCGCCCACCTCAGCAGGG + Intronic
1194151287 X:90327141-90327163 CAGCCTTCTCAGCCTCAGCCTGG - Intergenic
1194151955 X:90337271-90337293 GATCCTGTTCAACCCTAGCAGGG + Intergenic
1200497656 Y:3903895-3903917 CAGCCTTCTCAGCCTCAGCCTGG - Intergenic
1200498315 Y:3914037-3914059 GATCCTGTTCAACCCTAGCAGGG + Intergenic
1200767281 Y:7090944-7090966 CAGACTTCTCAGCCTCAGCATGG - Intronic