ID: 1146386114

View in Genome Browser
Species Human (GRCh38)
Location 17:32375044-32375066
Sequence GCTCAGAGTAAACTGCTATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146386114_1146386115 17 Left 1146386114 17:32375044-32375066 CCAGATAGCAGTTTACTCTGAGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1146386115 17:32375084-32375106 AGTATAGCATTTAGCAAACCTGG 0: 1
1: 0
2: 1
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146386114 Original CRISPR GCTCAGAGTAAACTGCTATC TGG (reversed) Exonic
900033334 1:386982-387004 GTTCAGAATAAACTGCCTTCAGG - Intergenic
900054172 1:616871-616893 GTTCAGAATAAACTGCCTTCAGG - Intergenic
902211440 1:14907641-14907663 GCTCAGAGGAGACTTCTTTCCGG - Intronic
916653888 1:166855708-166855730 GCACAGAGGAAACTGCAAACTGG - Intronic
920241343 1:204553285-204553307 GTTCAGAGTTTACTGCTATAAGG + Exonic
920922834 1:210312261-210312283 GGTCAGAATAAACTGCTCTTTGG - Intergenic
921085150 1:211783952-211783974 GGTCAGAGAAAGCTGCTATGAGG + Intronic
922255694 1:223891136-223891158 GTTCAGAATAAACTGCCTTCAGG - Intergenic
924055015 1:240116519-240116541 GCTGAGAGTAAAATGCTTTAAGG + Intronic
924336890 1:242994001-242994023 GTTCAGAATAAACTGCCTTCAGG - Intergenic
924832055 1:247606483-247606505 GCTCTGAGGAAACTTCTCTCGGG + Exonic
1066011490 10:31198018-31198040 GCTCAGAAAAAACTGCTTTAGGG + Intergenic
1071575606 10:86723646-86723668 GCACAGAGTGAACTGCAACCTGG + Intronic
1080248792 11:30209535-30209557 GATAAAAGTAAAATGCTATCAGG + Intergenic
1084946367 11:72641120-72641142 GGGAAGAGTAAACTGCAATCTGG - Intronic
1087407450 11:97746931-97746953 AATCAGAGAAAACTGCTAACTGG + Intergenic
1087995327 11:104799669-104799691 GCCCTGAGAAAACTGGTATCTGG - Intergenic
1088592186 11:111413428-111413450 GTTCAGAGTCTACTGCTATGTGG - Intronic
1091704648 12:2685642-2685664 GATCAGAGCAAAGTGCTTTCCGG + Intronic
1091711220 12:2741980-2742002 GATCAGAGCAAAGTGCTTTCTGG + Intergenic
1093422492 12:18990943-18990965 GCTCAGAAGAAACTGCTTTGTGG + Intergenic
1096407536 12:51354739-51354761 GCTGAGAGAAAAATGCTTTCAGG + Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1109914402 13:68962092-68962114 GCACAGAGTCAAATGGTATCAGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1120369498 14:83614624-83614646 TGACAGACTAAACTGCTATCTGG - Intergenic
1120587346 14:86329394-86329416 GCTCACAGTAGCCTGCCATCAGG - Intergenic
1129184756 15:73899316-73899338 GCTCACAGGAAGCTGCCATCTGG + Intergenic
1135353341 16:21749068-21749090 ACTCAGAGAAAACTGCCCTCTGG - Intronic
1135451828 16:22565191-22565213 ACTCAGAGAAAACTGCCCTCTGG - Intergenic
1137679714 16:50329842-50329864 GCTCAGTTAAAACTGCTATTTGG + Intronic
1141146531 16:81534201-81534223 GCTCAGAGTCCACTGCTATTGGG - Intronic
1146386114 17:32375044-32375066 GCTCAGAGTAAACTGCTATCTGG - Exonic
1153956665 18:10102187-10102209 GCTCAGTGTGAGCTGCTAACTGG - Intergenic
1155083877 18:22436603-22436625 GCTCAGAATACACTGCTAAGTGG - Intergenic
1155653068 18:28163903-28163925 ACCCAGAGTTAACTACTATCTGG - Intronic
1157262448 18:46187901-46187923 GTTTAGACTAAACTGCTATGAGG + Intronic
1160359233 18:78256702-78256724 GCTCATAGTGAACTTCTATTTGG + Intergenic
1161427848 19:4213935-4213957 GCTTAGAGAAAACTCCTTTCTGG - Intronic
1164150740 19:22548339-22548361 GCTCTGAGAAACCTGGTATCTGG - Intergenic
926485927 2:13458095-13458117 GATCAGAGTAAAGTGTTAGCAGG + Intergenic
926802523 2:16671576-16671598 GCTCAAAGTCAACTGCTGTTAGG - Intergenic
930366738 2:50448559-50448581 TCCCAGAGTGAACTGCTATTTGG + Intronic
932707703 2:74039373-74039395 GCTCAGTATATACAGCTATCTGG - Intronic
936619847 2:114084179-114084201 GCTCAGAGGAAACTGCTTTATGG - Intergenic
938647753 2:133349020-133349042 GCTCAAAGTAAGCTGCTTTTGGG - Intronic
939402877 2:141717185-141717207 GCTGAGAGAAAATTGCTTTCTGG - Intronic
939950795 2:148469666-148469688 GCTGAGAGTAAACTACTTGCTGG - Exonic
1169751540 20:8999560-8999582 GCTCAAAGTAAAAAGCAATCTGG + Intergenic
1172435869 20:34928596-34928618 GCTCAGGGTAAGCTGCTCTGAGG - Exonic
1173556991 20:43973318-43973340 GCTCTGATTAAAATGCTCTCAGG - Intronic
950466952 3:13161375-13161397 GCTCAGAGAGAACTGCAGTCAGG + Intergenic
950967789 3:17158003-17158025 GTTCAGAGGTAACTGCAATCCGG - Intronic
960546705 3:118923046-118923068 ACTCAGAGTGAGCTGCTTTCCGG + Intronic
962334383 3:134513491-134513513 GCTTGAAGTAAAATGCTATCAGG + Intronic
964817152 3:160729323-160729345 GCTCAGAGTATATTGCGCTCAGG + Intergenic
966741550 3:183239139-183239161 GCTCTGAGTAGATTGCCATCAGG - Intronic
978547409 4:109886390-109886412 GCTAAGGGTAAAATGATATCAGG - Intergenic
979240234 4:118441303-118441325 GTTCAGAATAAACTGCCTTCAGG + Intergenic
985008944 4:185562681-185562703 GTTCTGAGTAAACTTCTCTCTGG - Intergenic
985237286 4:187889887-187889909 GCTCAGAGTCAACTGTTTACAGG - Intergenic
987235319 5:15936404-15936426 GCTCAGAGCAACCTGCCAGCAGG - Intronic
999691562 5:154150456-154150478 GCTCAGAGCAAATTGCCATAAGG + Intronic
1002740486 5:181431886-181431908 GTTCAGAATAAACTGCCTTCAGG + Intergenic
1004804431 6:19187383-19187405 ACTCAGAATAAACTGTTAGCCGG - Intergenic
1005483295 6:26275059-26275081 GTTCACAGTAAGCTGCTATGTGG - Intergenic
1007780958 6:44254495-44254517 GCTCAGAATAAACTGCTTACTGG + Exonic
1008000038 6:46350775-46350797 CCTCAGAGTAAAATACTACCTGG + Intronic
1012711991 6:102618256-102618278 GCTGACAGTAAACTGATACCAGG + Intergenic
1019245596 6:170707487-170707509 GTTCAGAATAAACTGCCTTCAGG + Intergenic
1021204025 7:17757827-17757849 GCTCAGAGTCAAATAATATCTGG + Intergenic
1023815701 7:43948360-43948382 CCTCAGAGCATACTGCTTTCAGG + Intronic
1032649719 7:133864804-133864826 GCTCTGAGGAATCTGATATCTGG - Intronic
1035502528 8:100715-100737 GTTCAGAATAAACTGCCTTCAGG - Intergenic
1041799553 8:61784353-61784375 GCTCTGACTAAACTGCTAGTGGG + Intergenic
1044118112 8:88359462-88359484 GCTCAAAGTCAACAGCTATCAGG - Intergenic
1048273406 8:133047325-133047347 GCACAGAGGAAACTGATATCGGG + Intronic
1051062569 9:13061431-13061453 GCTCACAGAAAACTAGTATCTGG - Intergenic
1052068202 9:24049001-24049023 GCTCCCAGTAAACTCCTAACAGG + Intergenic
1054933171 9:70657808-70657830 GATCAAAGTAAACTGCATTCTGG + Intronic
1060872287 9:127052215-127052237 GCTAAGAGAAACCTGCTAACAGG - Intronic
1061110144 9:128563442-128563464 TCTCAGAGTATACTGCCATGTGG + Intronic
1061388486 9:130304268-130304290 GCGCTAAGCAAACTGCTATCTGG - Intronic
1061796793 9:133090286-133090308 GCTCAGAGTCACCTGCAATCTGG + Intergenic
1203605795 Un_KI270748v1:56694-56716 GTTCAGAATAAACTGCCTTCAGG + Intergenic
1189118206 X:38365680-38365702 GCCCACAGTAAACTGATGTCAGG + Intronic
1193891659 X:87053527-87053549 GCTCAAAATAAATTTCTATCCGG + Intergenic
1197244069 X:124150157-124150179 GCTCTGAGTAAATTGATAACAGG - Intronic
1199637629 X:149828349-149828371 GCTGAGAGGAAACAGCTCTCAGG - Intergenic
1199685069 X:150258321-150258343 GCTCAAGGTAAACTGCTGTTGGG + Intergenic