ID: 1146386778

View in Genome Browser
Species Human (GRCh38)
Location 17:32383869-32383891
Sequence GTCCCACTCCTTGTCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146386778_1146386781 23 Left 1146386778 17:32383869-32383891 CCAGCCTGGACAAGGAGTGGGAC No data
Right 1146386781 17:32383915-32383937 AAAAACATCGACTAGAGCAGTGG No data
1146386778_1146386782 29 Left 1146386778 17:32383869-32383891 CCAGCCTGGACAAGGAGTGGGAC No data
Right 1146386782 17:32383921-32383943 ATCGACTAGAGCAGTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146386778 Original CRISPR GTCCCACTCCTTGTCCAGGC TGG (reversed) Intergenic
No off target data available for this crispr