ID: 1146387349

View in Genome Browser
Species Human (GRCh38)
Location 17:32389070-32389092
Sequence TCCCTCTCTTGAGGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146387349_1146387357 27 Left 1146387349 17:32389070-32389092 CCAGCTCCCCCTCAAGAGAGGGA No data
Right 1146387357 17:32389120-32389142 CGGGTTAAAAGTTTTATATTAGG No data
1146387349_1146387354 0 Left 1146387349 17:32389070-32389092 CCAGCTCCCCCTCAAGAGAGGGA No data
Right 1146387354 17:32389093-32389115 GACACTTTTAGCTTGTATTTTGG No data
1146387349_1146387355 7 Left 1146387349 17:32389070-32389092 CCAGCTCCCCCTCAAGAGAGGGA No data
Right 1146387355 17:32389100-32389122 TTAGCTTGTATTTTGGTTTACGG No data
1146387349_1146387356 8 Left 1146387349 17:32389070-32389092 CCAGCTCCCCCTCAAGAGAGGGA No data
Right 1146387356 17:32389101-32389123 TAGCTTGTATTTTGGTTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146387349 Original CRISPR TCCCTCTCTTGAGGGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr