ID: 1146394809

View in Genome Browser
Species Human (GRCh38)
Location 17:32456336-32456358
Sequence CTGAGTGAGCTCTAGGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146394809_1146394813 9 Left 1146394809 17:32456336-32456358 CCCATAACCTAGAGCTCACTCAG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1146394813 17:32456368-32456390 CAGCATTTATTTTTTTTTATTGG 0: 1
1: 1
2: 27
3: 270
4: 2262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146394809 Original CRISPR CTGAGTGAGCTCTAGGTTAT GGG (reversed) Intronic