ID: 1146398836

View in Genome Browser
Species Human (GRCh38)
Location 17:32488024-32488046
Sequence GACCCGTTTGGGCGTCCCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146398836_1146398843 17 Left 1146398836 17:32488024-32488046 CCGCAGGGACGCCCAAACGGGTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1146398843 17:32488064-32488086 CAGTGAGCTGCTTCGCTGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 218
1146398836_1146398844 18 Left 1146398836 17:32488024-32488046 CCGCAGGGACGCCCAAACGGGTC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1146398844 17:32488065-32488087 AGTGAGCTGCTTCGCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146398836 Original CRISPR GACCCGTTTGGGCGTCCCTG CGG (reversed) Exonic
904050360 1:27634799-27634821 GACCTTTTTGGGGGTCCCTTTGG + Intronic
904563179 1:31412357-31412379 GACCAGTTTGGGCATCCCTAGGG + Intronic
904585873 1:31580332-31580354 GACCTGTGTGGGCAGCCCTGGGG + Intronic
1062767974 10:80013-80035 GACCTGTTTGTGCCTTCCTGAGG - Intergenic
1066370355 10:34814661-34814683 GACCCGGCTGGGTGTCCCAGAGG + Intronic
1066802554 10:39207150-39207172 GGCGCCTTTGGGGGTCCCTGGGG + Intergenic
1075773208 10:124958697-124958719 CAACAGTTTGGGAGTCCCTGTGG + Intronic
1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG + Intronic
1082010961 11:47449290-47449312 CACCCCCTTGGGCGTCCCTTAGG + Intergenic
1083681419 11:64353532-64353554 ATCCCCTTTGGGCGTTCCTGGGG + Intronic
1083681626 11:64354264-64354286 GACCCCATTGGCCTTCCCTGAGG + Intronic
1085157839 11:74312076-74312098 GACTCTTCTGGACGTCCCTGTGG - Intergenic
1104022564 12:125003178-125003200 GACCCGTTTGCATGTGCCTGAGG + Intronic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1122738716 14:103858553-103858575 GACCCGTCTGGCAGCCCCTGAGG + Intergenic
1125478920 15:40066852-40066874 AACCCCTTTGGGCACCCCTGGGG - Intergenic
1141184703 16:81779190-81779212 GACCCGGCTGGGCGCGCCTGGGG + Intronic
1144803654 17:17949389-17949411 GACCCAGTTGGGCCTCCTTGGGG - Intronic
1146329730 17:31917342-31917364 GGCCCGCTTGGGCGCCCCAGAGG - Intergenic
1146398836 17:32488024-32488046 GACCCGTTTGGGCGTCCCTGCGG - Exonic
1157469184 18:47975227-47975249 GATCCGTTTCAGCATCCCTGAGG - Intergenic
1162031127 19:7917695-7917717 GACACTCTTGGGCGGCCCTGTGG - Exonic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
927865536 2:26585123-26585145 GACCCATTTAGGCAGCCCTGAGG - Intronic
1169208617 20:3753725-3753747 GACCCTGGTGGGAGTCCCTGTGG + Exonic
1180670489 22:17548939-17548961 GGTCCGCTTGGGCTTCCCTGGGG - Exonic
1184465819 22:44668565-44668587 GACCCGGGTGGGCGTGCCCGCGG + Intronic
1184837832 22:47034523-47034545 GCCCTGTTTGGGAATCCCTGAGG + Intronic
953069973 3:39509844-39509866 GACCCTGCTGGGGGTCCCTGGGG - Intronic
958751914 3:98201939-98201961 GCCCCATTTGGGAGTCTCTGTGG + Intergenic
961007079 3:123412351-123412373 GACCCAATAGGACGTCCCTGCGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
987425619 5:17769414-17769436 GACTGGTTTGAGTGTCCCTGGGG - Intergenic
990976442 5:61565479-61565501 ATCCCATTTGGGCCTCCCTGAGG - Intergenic
1024054022 7:45648186-45648208 CACCCATCTGGGTGTCCCTGGGG - Intronic
1026153483 7:67807892-67807914 GACCCCTTTGGGGATCCATGAGG + Intergenic
1028340956 7:89719186-89719208 ACCCAGTTTGGGCTTCCCTGTGG - Intergenic
1035994314 8:4529151-4529173 GACCCTTTGGGGGATCCCTGAGG + Intronic
1036702861 8:11024712-11024734 GGCCCTCTTGGGCCTCCCTGGGG - Intronic
1045484706 8:102622019-102622041 GACCCATTTGGAGGTCCCCGGGG - Intergenic
1057207968 9:93184636-93184658 GACCTGCTAGGGTGTCCCTGAGG - Intergenic
1060228700 9:121811771-121811793 GATCCTCTTGGGCGACCCTGAGG + Intergenic
1185479437 X:435107-435129 GATCCGTGTGGGGGTTCCTGGGG + Intergenic
1188006320 X:25017869-25017891 GACCCTCGCGGGCGTCCCTGCGG + Intergenic
1188844647 X:35058339-35058361 TACCTGTTTGGGCCTCCCAGAGG - Intergenic