ID: 1146399890

View in Genome Browser
Species Human (GRCh38)
Location 17:32494212-32494234
Sequence GGGTGAGCAGAGTCACCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 177}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146399890_1146399904 16 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399904 17:32494251-32494273 GGCTGGGAGTTGGGTTGGGGTGG 0: 1
1: 3
2: 9
3: 161
4: 1260
1146399890_1146399902 12 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399902 17:32494247-32494269 TGGCGGCTGGGAGTTGGGTTGGG 0: 1
1: 0
2: 1
3: 26
4: 369
1146399890_1146399897 -1 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399897 17:32494234-32494256 CAGTGGCTTTGGCTGGCGGCTGG 0: 1
1: 0
2: 1
3: 29
4: 216
1146399890_1146399899 6 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399899 17:32494241-32494263 TTTGGCTGGCGGCTGGGAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 287
1146399890_1146399894 -5 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399894 17:32494230-32494252 CACCCAGTGGCTTTGGCTGGCGG 0: 1
1: 0
2: 2
3: 25
4: 244
1146399890_1146399901 11 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399901 17:32494246-32494268 CTGGCGGCTGGGAGTTGGGTTGG 0: 1
1: 1
2: 3
3: 34
4: 409
1146399890_1146399893 -8 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399893 17:32494227-32494249 GCTCACCCAGTGGCTTTGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 195
1146399890_1146399900 7 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399900 17:32494242-32494264 TTGGCTGGCGGCTGGGAGTTGGG 0: 1
1: 0
2: 1
3: 34
4: 346
1146399890_1146399905 17 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399905 17:32494252-32494274 GCTGGGAGTTGGGTTGGGGTGGG 0: 1
1: 4
2: 13
3: 143
4: 1222
1146399890_1146399903 13 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399903 17:32494248-32494270 GGCGGCTGGGAGTTGGGTTGGGG 0: 1
1: 3
2: 1
3: 45
4: 476
1146399890_1146399898 0 Left 1146399890 17:32494212-32494234 CCTGTGGGTGACTCTGCTCACCC 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1146399898 17:32494235-32494257 AGTGGCTTTGGCTGGCGGCTGGG 0: 1
1: 0
2: 4
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146399890 Original CRISPR GGGTGAGCAGAGTCACCCAC AGG (reversed) Exonic
900119890 1:1044077-1044099 AGGGGAGCAGAGTCACCCAGGGG - Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900928636 1:5721716-5721738 GGGTGTGGAGAATGACCCACAGG + Intergenic
901836049 1:11925074-11925096 AGTTGAGCAGATTCAACCACTGG + Intronic
904581431 1:31546976-31546998 GGGTGAGCAGAGTGAGTCAGAGG + Intergenic
904622114 1:31781908-31781930 GAGGGAGCACAGCCACCCACGGG + Intergenic
904634534 1:31869682-31869704 TGATGAGCAGAGTCTGCCACAGG + Intergenic
905366681 1:37455389-37455411 GGCTGGGCAGAGGCACCCACAGG - Intergenic
910853350 1:91670177-91670199 GGCTGGTCAGAGTCCCCCACAGG + Intergenic
911123589 1:94319799-94319821 GGGTGGGCAGAGTGACCCTGGGG - Intergenic
915117123 1:153608198-153608220 AGATGAGAAGAGACACCCACAGG + Intronic
919513586 1:198494819-198494841 GGCTGGGCCGAGCCACCCACCGG - Intergenic
920238877 1:204529306-204529328 CTGTGATCAGAGTCACCGACTGG + Intronic
920654787 1:207867425-207867447 GGGGGAGTAGGTTCACCCACAGG + Intergenic
920658186 1:207891961-207891983 GGGTGAGCAGAGGAAGCCAGTGG + Intronic
921592373 1:217019736-217019758 GGAAGAGCAGAGTCATCCCCAGG + Intronic
922776821 1:228218542-228218564 GGTTGAGCAGAGCCACAGACTGG + Intronic
1062860764 10:807546-807568 GGGTGAGCAGCTCCACCCAGAGG - Exonic
1063660269 10:8030887-8030909 AGGTGAGCAGAGACACCACCTGG - Intergenic
1065129328 10:22604729-22604751 TGCTGAGTAGAGTCTCCCACCGG - Intronic
1070154950 10:73827585-73827607 GGGTGGGCAGAATAAACCACTGG + Intronic
1070933990 10:80279398-80279420 GGGTGATCAGAGAAACCCACAGG + Intronic
1071522817 10:86341493-86341515 GGGTGAGCATCCTCCCCCACAGG + Intronic
1074530953 10:114298388-114298410 GAGGGTGCAAAGTCACCCACTGG - Intronic
1076233491 10:128843367-128843389 GTGTGTGCATAGACACCCACAGG + Intergenic
1076428007 10:130381095-130381117 GGGTGTCCAGTGTCCCCCACCGG + Intergenic
1076923389 10:133467167-133467189 AGGTGAGCATGGTCACACACAGG - Intergenic
1077018164 11:406121-406143 GGGTGAGCAGGGGCAGCCCCTGG - Intronic
1077252998 11:1568854-1568876 GGGAGAGCATCCTCACCCACAGG + Intronic
1077938252 11:6813250-6813272 GGAGGGGCACAGTCACCCACTGG + Intergenic
1078452172 11:11448723-11448745 GGGTGAGCAGAGTCAGTGACTGG - Exonic
1084363246 11:68682878-68682900 GGGAGAGGAGAGTCAGGCACAGG - Intergenic
1084959242 11:72707577-72707599 GGCTGGGCAGAGCCCCCCACTGG - Intronic
1088955947 11:114615020-114615042 GGGTAACCAGTGTTACCCACTGG + Intergenic
1088956179 11:114616610-114616632 GGGTAACCACAGTTACCCACTGG + Intergenic
1089602348 11:119623718-119623740 GGGTGAGAACAGCCACCCCCAGG - Intronic
1089688518 11:120171782-120171804 GAGAGAGCAGAATCTCCCACAGG - Intronic
1091274650 11:134342201-134342223 GCTAGAGCAGAGTCCCCCACGGG - Intronic
1091299664 11:134499383-134499405 GGGTGTGCACAGGCACACACGGG - Intergenic
1091814846 12:3429863-3429885 GGCTGGTCAGAGTCCCCCACAGG + Intronic
1098032304 12:66267161-66267183 GGGAGTGCAGAGACACCCAGTGG - Intergenic
1099922906 12:88981299-88981321 GGGTGAGAAGAGACACACAAGGG - Intergenic
1100580689 12:95937240-95937262 GGGTGAGTAGAGTGAGGCACTGG - Intronic
1103907641 12:124335645-124335667 GGGGGTGCAGAGTCAGGCACCGG + Intronic
1109403523 13:61867343-61867365 GGGAGAGCAAAATCACACACTGG - Intergenic
1110653999 13:77975502-77975524 GGCTGGCCAGAGTCCCCCACCGG + Intergenic
1111818373 13:93183478-93183500 GGGGCAGCAGAGTCAGCCAGAGG - Intergenic
1112166975 13:96930533-96930555 GGGTGAGCACAGTGACCTAATGG - Intergenic
1113939279 13:114010216-114010238 TGGGGAGCAGAGGCCCCCACTGG - Intronic
1117488997 14:56227324-56227346 GAGTGAGGAGAGTGCCCCACTGG + Intronic
1117980185 14:61335141-61335163 GGCTGAGGATAGACACCCACAGG + Intronic
1121248496 14:92482395-92482417 GGGGGAACAGACTCACCCAGAGG - Intronic
1121632543 14:95431847-95431869 GGGTGTGCAGAGTCCTCCGCTGG - Intronic
1122691146 14:103532712-103532734 GGGTGCGCACAGTCACCCAGCGG - Exonic
1122719484 14:103714310-103714332 GAGAGGGCAGAGTCAGCCACAGG + Intronic
1122720658 14:103720429-103720451 CAGTGAGAAGCGTCACCCACTGG - Intronic
1124104286 15:26722853-26722875 AGCTGAGCAGAGGCACCCAGTGG - Intronic
1125542594 15:40478837-40478859 GAGGGAGCAGACTCACCCAGAGG + Intergenic
1126401861 15:48280053-48280075 GGGAGAGCAGGGAAACCCACTGG - Intronic
1129180139 15:73869022-73869044 GAATGAGCAGAGTCTCCCAGTGG - Intergenic
1131137950 15:89952871-89952893 GGGTGAGGAGATGTACCCACTGG + Intergenic
1131357473 15:91758228-91758250 GGTTGAGCACAGTGACCCAAGGG + Intergenic
1131379638 15:91953460-91953482 GGCTTAGGAGAGTTACCCACAGG + Intronic
1133174798 16:4006106-4006128 GGGGGTGCAGAGTCACCCCTGGG - Intronic
1135539444 16:23318785-23318807 TGGGGCGCAGAGTCACCCATAGG + Intronic
1139545812 16:67649054-67649076 GCGTGACCCGAGTCACCCCCAGG + Exonic
1139653614 16:68374802-68374824 GGGGACACAGAGTCACCCACAGG + Intronic
1139715501 16:68810055-68810077 GTGTGAGAAAAGTCACCCACTGG + Intronic
1141145113 16:81523775-81523797 AGGTGAGCTGAGTCACCACCAGG + Intronic
1141630798 16:85286987-85287009 GGGCGGGCAGAGTGACCCGCTGG - Intergenic
1142118763 16:88375573-88375595 GGATGAGCAGAGGCACCGGCAGG - Intergenic
1144005554 17:11096087-11096109 GGGTGTGCATAGCCACCTACAGG - Intergenic
1145000526 17:19301640-19301662 GTGTCAGCAGAGGCACCCAAGGG - Intronic
1146399890 17:32494212-32494234 GGGTGAGCAGAGTCACCCACAGG - Exonic
1148246388 17:46033553-46033575 CAGAGAGCAGTGTCACCCACAGG - Intronic
1149581264 17:57751973-57751995 GGGTGAGGAGAGATGCCCACGGG + Intergenic
1150009775 17:61492977-61492999 GGCAGAGCTGACTCACCCACAGG - Intergenic
1155824210 18:30418844-30418866 GGGCATGCAGAGTCACACACAGG + Intergenic
1156303278 18:35854001-35854023 GGGTGGTCACAGTCACCCAGAGG + Intergenic
1157625620 18:49048348-49048370 GGGTGTGCAGAGTCCCCCAGTGG + Intronic
1158735660 18:60075770-60075792 GGCTGAGCAGAGCCATCCCCAGG - Intergenic
1160152468 18:76405716-76405738 GTGTCAGCGGAGTCACCAACCGG - Intronic
1160970624 19:1766322-1766344 GCGCGCGCAGAGGCACCCACGGG + Intronic
1161377701 19:3948702-3948724 GCGGGAGCAGAATCACCCCCAGG - Intergenic
1165282050 19:34806015-34806037 GGGCTAGAAGAGTCACACACAGG + Intergenic
1166299465 19:41905873-41905895 GGGTGAAGAGAGGCATCCACAGG + Intronic
1166886008 19:45961213-45961235 GGGTGAGCAGAGGAAACCCCAGG + Intronic
925351816 2:3206315-3206337 GGGTGTGCAGAGCCTCCCTCAGG - Intronic
926302900 2:11617191-11617213 GGGTGGGCAGTGCCAACCACAGG + Intronic
927088811 2:19694920-19694942 GGGTCAGTAAAGCCACCCACTGG + Intergenic
927402277 2:22726435-22726457 AGGTGAGCACAGTAACCCATAGG + Intergenic
928662937 2:33521969-33521991 GGATGAGAAGAGTCACACAGAGG + Exonic
929801657 2:45109802-45109824 GGGTGATTCTAGTCACCCACTGG + Intergenic
931811769 2:65861167-65861189 AGGTGAGCACAGTCACCCCGTGG - Intergenic
933726422 2:85430076-85430098 AGGTGTGCAGAGTCACTCAGGGG - Intronic
934850993 2:97701109-97701131 GAGTGAACAGAGATACCCACCGG - Intergenic
935649034 2:105366405-105366427 GGGTGAGCAGAGTCAATAACAGG + Intronic
938729098 2:134131983-134132005 GGGTTACCTGAATCACCCACTGG + Intronic
938993968 2:136658063-136658085 GGGGCAGTAGAGTCACACACAGG - Intergenic
940001134 2:148967171-148967193 GGCTAAGGAGAGCCACCCACTGG + Intronic
941181502 2:162264839-162264861 GGTTGCTCAAAGTCACCCACTGG + Intergenic
942045596 2:172097515-172097537 GGGAGGGCACAGTCACCCTCAGG + Intergenic
948786600 2:240355994-240356016 GGGTGCGGGGAGTCACCCCCTGG - Intergenic
948833867 2:240614574-240614596 GGGAGAGCAGAGTCCTCCTCAGG - Intronic
1168910130 20:1440749-1440771 GGGTGACCAGGGGCACCCAGAGG + Intergenic
1173556123 20:43967115-43967137 GGGAGACCAGAGTCACCCCAGGG + Intronic
1174585815 20:51607377-51607399 GGGTGAGCAGGGTCTCCCCTGGG + Intronic
1175960074 20:62631481-62631503 GGCTGGGCCAAGTCACCCACTGG - Intergenic
1175966749 20:62663691-62663713 GGGGGAGAAGGGTCACGCACAGG + Intronic
1176240336 20:64072970-64072992 GGTTAAGCACAGCCACCCACTGG + Intergenic
1176672790 21:9750432-9750454 GGGCCAGCAGGGTGACCCACTGG - Intergenic
1177486833 21:21769042-21769064 GGGTGAGCATAGTACCCCACAGG - Intergenic
1179044215 21:37830424-37830446 GGGGGAGCAAAGTCACCCCCAGG - Intronic
1179729693 21:43360829-43360851 GGGAGAGCGCAGTCACCCAGGGG - Intergenic
1181066621 22:20309475-20309497 GGGTGGGCAGAGTGACCTGCTGG + Intergenic
1181547064 22:23608097-23608119 GGGTGAGAAGAGGCCCCCCCAGG + Intergenic
1184369016 22:44070818-44070840 AGGTGAGCAAAGTCCCGCACAGG - Intronic
1185117502 22:48945995-48946017 GGGTGCCCAGAGACTCCCACAGG - Intergenic
954711549 3:52507498-52507520 GGATGAGAAGAGCCAACCACAGG - Intronic
957330557 3:78758039-78758061 GGCTGAGCAGACTCTCCCAAGGG - Intronic
961010004 3:123429417-123429439 GGCTGAGCACAGGCACTCACTGG - Intronic
962352310 3:134665034-134665056 AGGTGGGCAGAGCCACCCTCAGG + Intronic
962372601 3:134833370-134833392 GGGTGAGCTGTGTCCCCAACAGG + Intronic
963574946 3:147048399-147048421 GGGTGAACAGAGGCAGACACAGG + Intergenic
963758346 3:149259274-149259296 GAGTGGGCAGACTCACCCTCAGG - Intergenic
963903321 3:150753226-150753248 GGGTGAGCAGAGGCAAGAACTGG + Intronic
966872729 3:184301904-184301926 GAGTGAGCAGAGGCTCCCGCTGG - Exonic
967848629 3:194064804-194064826 GGGTCAGAAGAGTAACTCACGGG - Intergenic
968080954 3:195846820-195846842 GGGGAGGCAGAGTCACCCACTGG - Intergenic
968761659 4:2445385-2445407 GGGGGAGCCCAGTCCCCCACAGG - Intronic
970200834 4:13602923-13602945 GGGAGAGCAGAGTGATCCGCAGG + Exonic
971142103 4:23935180-23935202 GGGTGAGCAGGATCAAGCACTGG + Intergenic
971352403 4:25865135-25865157 AGGTAAGCAGAGTGCCCCACTGG + Intronic
977299643 4:95253538-95253560 AGGAGAGCAGTGTCCCCCACAGG - Intronic
983205044 4:164902792-164902814 GGGTGTGCAGAGACCCCCTCTGG - Intergenic
985401925 4:189601393-189601415 GGGCCAGCAGGGTGACCCACTGG + Intergenic
985551458 5:535419-535441 AGGGGAGCACAGACACCCACGGG - Intergenic
985566487 5:620925-620947 GGGTCAGCAGAGACACCACCAGG - Intronic
985849536 5:2378624-2378646 GGGTGTGGAGTGTCACCCACCGG - Intergenic
985898221 5:2763240-2763262 TGGGGAGCAAAGTCACCCACAGG - Intergenic
986095827 5:4553393-4553415 AGGTGGTCTGAGTCACCCACAGG - Intergenic
986539274 5:8827085-8827107 GGGAGAGCAGAGCCTCACACAGG - Intergenic
987872810 5:23642447-23642469 GGGTGAGGAGCATCACACACTGG - Intergenic
990884716 5:60578395-60578417 GGGTGAGCTGTGTAACCAACAGG + Intergenic
995056948 5:107770019-107770041 GGGTGAGCAGAGTGACTTGCAGG + Intergenic
999557325 5:152757897-152757919 GGGTGGGGAGAATCACACACTGG + Intergenic
1000408066 5:160909611-160909633 TGATGTGCAGAGCCACCCACTGG + Intergenic
1000938142 5:167328015-167328037 GGGTTTGCAGAGGCAGCCACTGG + Intronic
1001331887 5:170767938-170767960 GGTTGAGCAGAGGAACCCAAGGG + Intronic
1002053179 5:176583544-176583566 GGGAGGGCAGAGTCACCTCCAGG + Intronic
1002213241 5:177610610-177610632 GGCTGAGGAGATTCACCCACAGG + Intergenic
1003112496 6:3261478-3261500 GGGTGACCAAAACCACCCACAGG - Intronic
1003521686 6:6863477-6863499 GAGTGAGAAGAGTCACCAACGGG - Intergenic
1004043720 6:12007768-12007790 GGGTGAGCAGAGTCCCATCCTGG - Intergenic
1005854938 6:29853371-29853393 GGGTGGGCAGAGGCAGCCTCAGG - Intergenic
1006060307 6:31414167-31414189 GGGTGGGCAGAGGCAGCCTCAGG + Intronic
1006072750 6:31508933-31508955 GGGTGGGCAGAGGCAGCCTCAGG + Intronic
1006603309 6:35239873-35239895 GGGTGAGCAGACTCAGCCAAAGG + Exonic
1007509759 6:42365993-42366015 GGGTGAGCAGAGGTACGCATGGG - Intronic
1013592284 6:111629306-111629328 TGGTGACCAGAGGCACCCAGTGG - Intergenic
1014828764 6:126076746-126076768 GGGTTAGGAGAGACACACACAGG - Intergenic
1016425876 6:143935188-143935210 GGCTGAGCAGACTCACCCTCAGG + Intronic
1016998630 6:149979215-149979237 GGGAGAGCACAGGCACCCCCAGG - Intergenic
1017669051 6:156752716-156752738 GGGTGAGCAGAGTGACCTCCAGG - Intergenic
1018640125 6:165897752-165897774 GGGGGAGAAAAGGCACCCACAGG - Intronic
1018857240 6:167683493-167683515 GGGGGTGCAGAGCCACCCGCTGG + Intergenic
1019261835 7:86204-86226 GGCTGAGCAGAGCCCACCACTGG - Intergenic
1019688817 7:2398235-2398257 TGCTGAGTAGAGACACCCACAGG - Intergenic
1022563385 7:31373072-31373094 GGGTGGGCACAGAAACCCACAGG - Intergenic
1024565499 7:50676770-50676792 GAGTGGGCAGGGTCACCCCCGGG + Intronic
1024581113 7:50801926-50801948 TGGAGACCAGAGACACCCACAGG + Intergenic
1024650715 7:51400906-51400928 GTGTGAGCAGAGACAAACACGGG + Intergenic
1024653400 7:51428402-51428424 GGGTCAGCAGTGACACCCAGTGG + Intergenic
1025054836 7:55756492-55756514 GTGTGAGCAGAGACAGACACAGG + Intergenic
1025132911 7:56386717-56386739 GTGTGAGCAGAGACAGACACGGG + Intergenic
1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG + Intronic
1034032282 7:147781371-147781393 GGGTGAGCAGTGTAAGCCCCAGG - Intronic
1035188259 7:157142730-157142752 GAGTGAGCACAGTTACCAACAGG - Intronic
1039077903 8:33709098-33709120 GGGTGCACACAGTCACACACAGG + Intergenic
1041207017 8:55510103-55510125 GGGGCAGGAGAGACACCCACAGG + Intronic
1044847007 8:96391889-96391911 GGGTAAGGAGAGTCCCGCACAGG + Intergenic
1047356755 8:124129452-124129474 GAGTGGGTAGGGTCACCCACTGG - Intergenic
1049378268 8:142299299-142299321 GGGAGAGCAGAACCAGCCACAGG + Intronic
1051326117 9:15970887-15970909 TGGTGAGCACAGTCCCCGACTGG - Intronic
1054159203 9:61661906-61661928 GGCTGAGCAGAGTCGCCAGCCGG - Intronic
1054478977 9:65592911-65592933 GGCTGAGCAGAGTCGCCAGCCGG - Intergenic
1055353364 9:75412382-75412404 GGGTGGGCAGAGTCAGGCAGGGG + Intergenic
1055367715 9:75562920-75562942 GGGTGGGGAAAGTCACACACTGG - Intergenic
1059429216 9:114240186-114240208 CAGAGAGCAGGGTCACCCACGGG - Intronic
1060050976 9:120377875-120377897 GGAGCACCAGAGTCACCCACTGG - Intergenic
1060286053 9:122253603-122253625 GGGCGAGAAGAGTCTCCCCCAGG + Intronic
1060917446 9:127399423-127399445 AGGTGAGCAGAGCCATCCCCAGG - Intronic
1061205141 9:129158632-129158654 GGCTGAGCAGAGGCACCCTCTGG + Intergenic
1061847508 9:133395966-133395988 GAGTGAGCAGACTGACCCCCAGG + Intronic
1062025774 9:134339748-134339770 GGGTGTGCACAGACACACACGGG - Intronic
1199849210 X:151713566-151713588 GGGTGAGCAGAACCTTCCACTGG + Intergenic
1200247346 X:154533229-154533251 GGGTGAGCAGAGCCAAGCAGGGG - Intronic