ID: 1146402531

View in Genome Browser
Species Human (GRCh38)
Location 17:32511122-32511144
Sequence TGTCCTCTGATTGATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146402531 Original CRISPR TGTCCTCTGATTGATGTGGG AGG (reversed) Intronic
901051901 1:6429551-6429573 TCTCCTCTGCTTGAAGTGAGGGG - Intronic
901230383 1:7638667-7638689 TACCCTCTGATTGAGATGGGAGG + Intronic
901488055 1:9579209-9579231 TGTCCGCTGTTTGGTGTGTGTGG - Intronic
901846361 1:11985168-11985190 TGTCCGCTGGTTGGTGTGTGGGG + Intronic
902482334 1:16718463-16718485 TCTCCTCTGCTTGAAGTGAGGGG + Intergenic
903772485 1:25772649-25772671 TGCCCTCTGAATGCTGTGTGGGG + Intronic
905813867 1:40932674-40932696 TGTCCTGTGCTGGATGTTGGGGG + Intergenic
907507981 1:54935735-54935757 TGTCCTCAGGCTGAGGTGGGAGG + Intergenic
908807886 1:67949476-67949498 TGGCCCCTGATTCCTGTGGGAGG - Intergenic
908854892 1:68415545-68415567 TCTCATCTAATTGATGTGGTTGG + Intergenic
912194268 1:107378867-107378889 TGCCCTCTGTTTCATGTGTGGGG - Intronic
912238181 1:107875651-107875673 TTTACTCTGACTGATATGGGAGG + Intronic
915183476 1:154083615-154083637 TGTCTGCTGCTTGATGTGTGGGG + Intronic
917956195 1:180101555-180101577 TGTCCACTGCTTGGTGTGTGGGG - Intronic
919622143 1:199874862-199874884 TGTCCTCCGCTTAATGTAGGAGG + Intergenic
921334892 1:214076112-214076134 TGTGCTCTCCTTGATGTGTGTGG - Intergenic
921784647 1:219215468-219215490 TGCCCTCTGATCTTTGTGGGTGG + Intergenic
923700611 1:236296644-236296666 TGTACTCTCAGTGCTGTGGGAGG + Intergenic
924429189 1:243982418-243982440 TGTCCTCCCATTTATGTTGGAGG + Intergenic
1063274994 10:4556280-4556302 ACTCATCTGATTGATTTGGGGGG + Intergenic
1065208117 10:23376039-23376061 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
1065667749 10:28080954-28080976 TGCACTCTGCTTTATGTGGGAGG + Intronic
1065935771 10:30519404-30519426 TGTCCACTGATTGTTGATGGGGG - Intergenic
1066236934 10:33494061-33494083 CTTCCTAAGATTGATGTGGGAGG + Intergenic
1066693800 10:38060417-38060439 TGACCACTGTTTGCTGTGGGAGG - Intronic
1066761400 10:38756966-38756988 TGTCTTCTCGTTGATGAGGGAGG + Intergenic
1066960182 10:42215458-42215480 TGTCTTCTCATTGATGAGGGAGG - Intergenic
1066999015 10:42588724-42588746 TGACCACTGTTTGCTGTGGGAGG + Intronic
1067820931 10:49529516-49529538 TGTCCTCTCTCTGATTTGGGAGG + Intronic
1069209708 10:65741069-65741091 TGTCCTTTGATTAATGTTGATGG - Intergenic
1070463178 10:76690412-76690434 TCTCCTCAGATTCATTTGGGGGG + Intergenic
1073995431 10:109310510-109310532 TGTCCCCTGATTTATGATGGAGG + Intergenic
1077529046 11:3086622-3086644 TGTCCTCTGGTTGCTGTGAGGGG + Intergenic
1077638133 11:3857057-3857079 TTTCTTCTGACTGATGAGGGTGG + Intronic
1078480896 11:11674513-11674535 TGTCCTCTGATTGATTTTTTTGG + Intergenic
1079759674 11:24312815-24312837 TGTACTCTGACTGATATAGGAGG + Intergenic
1089611398 11:119671457-119671479 GGTTCTCTGACTGAGGTGGGTGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092161884 12:6319585-6319607 TGTCTTCTGATGGATGGTGGAGG - Intronic
1094149237 12:27264040-27264062 TGTCTTCTCGTTGATGAGGGAGG + Intronic
1098823190 12:75259394-75259416 TTTCCTCTGATAGATGTGGGTGG + Intergenic
1098974948 12:76892711-76892733 TTTCCTCTGATCCATTTGGGTGG - Intergenic
1100976022 12:100123459-100123481 TGTCCACTGCTTGGTGTGTGGGG - Intronic
1101330994 12:103757848-103757870 GTTCCTCTGAGTGAAGTGGGGGG + Intronic
1103561757 12:121796533-121796555 TGTCTTCTGCCTCATGTGGGTGG - Intronic
1104503568 12:129309581-129309603 TCTCCTCTGAGTGATCCGGGTGG - Intronic
1105940087 13:25140321-25140343 TGTTCTCTGAGAGCTGTGGGTGG - Intergenic
1106316700 13:28600594-28600616 TGTGCTCTGAGTGGTGTTGGCGG - Intergenic
1106499289 13:30311726-30311748 TGTCCTCTGCTTTGTGTTGGTGG + Intergenic
1108408163 13:50124866-50124888 CGTCCTCTAACTGCTGTGGGAGG - Intronic
1108436295 13:50404712-50404734 TGTCCTCTGATTGCAAAGGGTGG + Intronic
1109984967 13:69968130-69968152 TGGCTTCTGATTGATCAGGGTGG - Intronic
1113079849 13:106507131-106507153 GGTCCTCTGATTGAGGGGTGAGG - Intronic
1115019463 14:28658515-28658537 TGCCCTTTAATAGATGTGGGTGG - Intergenic
1115567673 14:34638750-34638772 CGTCCTCTGCTTGGTGTGTGAGG - Intergenic
1117561582 14:56945617-56945639 TGTCCTCTGATGCATCTTGGAGG + Intergenic
1119320542 14:73727480-73727502 TGTCCTCTCTGTGATGGGGGAGG - Exonic
1122652513 14:103233136-103233158 TCTCCTCTGAGTAATGTGAGTGG - Intergenic
1202932111 14_KI270725v1_random:47248-47270 TGTCTTCTCGTTGATGAGGGTGG + Intergenic
1124271910 15:28289951-28289973 TGTCCTCTCACTGAGGTGTGTGG - Intronic
1124573369 15:30885874-30885896 TGACCTCTGAATTATGTGAGAGG - Intergenic
1126752584 15:51892379-51892401 TGTGCTCTGATGCATGTGTGTGG - Intronic
1127533273 15:59865587-59865609 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
1127787739 15:62371280-62371302 TGTCACCTGCTTGGTGTGGGGGG - Intergenic
1128052759 15:64678097-64678119 TGTTCTGTGATTGTTGTAGGAGG + Exonic
1128882521 15:71256774-71256796 TGACTTCTGATTGATGTTGGAGG + Intronic
1131832979 15:96366054-96366076 TCTCCTCTGGTGGATGTGGGAGG + Intergenic
1132998034 16:2833934-2833956 TGTCCTTCAATTGTTGTGGGTGG - Intronic
1133428057 16:5710590-5710612 CGTCCTGTGATTGTTGTGGTTGG + Intergenic
1133957865 16:10461901-10461923 TGTAATCTGACTGATGTGTGTGG + Intronic
1135256799 16:20947612-20947634 TGTCCACTGCTTAATGTGTGGGG + Intronic
1135387077 16:22051890-22051912 TGTCCACTGCTTGGTGTGTGGGG + Intronic
1137465995 16:48710236-48710258 TGGCTGCTGATTGATTTGGGTGG - Intergenic
1137917103 16:52443943-52443965 TGTCCTCTGTTTAAACTGGGAGG - Intronic
1139214207 16:65111527-65111549 AGTCCTCTGGGTGATGTGGCTGG + Intronic
1139801620 16:69527469-69527491 TATCCACTGAGTGATGTGGGAGG + Intergenic
1141607409 16:85162517-85162539 TGGCCTCTGATTTATGCGGCTGG - Intergenic
1143539149 17:7559126-7559148 TGCCCTCTGGTTGAGTTGGGGGG + Exonic
1146402531 17:32511122-32511144 TGTCCTCTGATTGATGTGGGAGG - Intronic
1147458080 17:40551119-40551141 TGTCCTAGGATTGTTGTGGAAGG - Intergenic
1148084862 17:44987928-44987950 TGTCCTCTGGTTGGGGCGGGAGG + Intergenic
1148200400 17:45746422-45746444 GGAGCTCTGGTTGATGTGGGAGG - Intergenic
1148700236 17:49582555-49582577 TGTCCTCAGTCTGATGAGGGAGG - Intronic
1151607114 17:75144793-75144815 TGTCCACTGATTGGCGTGTGGGG + Intronic
1152395439 17:80030203-80030225 TGTCCTCGGTTTGGTGTGGTTGG - Intronic
1152852051 17:82642704-82642726 TGTCCACTGCTTGGTGTGTGGGG + Intronic
1155397076 18:25397966-25397988 TTTCCTGTGCTTGAGGTGGGAGG - Intergenic
1159086835 18:63802204-63802226 TGCCCTGTGACTGATGTGGCAGG + Intronic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1162394895 19:10411843-10411865 TGGCTTCTGACTGATGAGGGTGG + Intronic
1165142781 19:33712425-33712447 TGACCCCTGGTTGCTGTGGGAGG + Intronic
1166744554 19:45134869-45134891 TGTGGTCTGATTGCTGTGTGGGG + Intronic
925254271 2:2468872-2468894 TGACCTCTGCTTGATCTAGGTGG + Intergenic
927625151 2:24708374-24708396 TATTCTCTGATTGCTGAGGGTGG - Intronic
928210136 2:29317816-29317838 TGTTATCTCATTGGTGTGGGTGG - Intronic
933997873 2:87683161-87683183 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
934324713 2:92001640-92001662 TGTCTTCTCGTTGATGAGGGAGG + Intergenic
934463092 2:94232345-94232367 TGTCTTCTCGTTGATGAGGGAGG + Intergenic
935358146 2:102223878-102223900 TGTCTTATGATTGAAGTGAGAGG + Intronic
936295977 2:111267705-111267727 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
939619623 2:144402508-144402530 AGTCCTCTGAGGGCTGTGGGGGG - Intronic
939700591 2:145386339-145386361 TGTCCTTTGATTTATGTAGCAGG + Intergenic
942696366 2:178651419-178651441 TGTCCACTGTTTGATGGGGGCGG - Intronic
943447779 2:188010347-188010369 TCTCCTCTCATTTATGTGAGGGG + Intergenic
944003717 2:194876036-194876058 TGGCTTCTGATTGATCAGGGTGG - Intergenic
948740820 2:240044656-240044678 TGTTCTCTGATTGTCTTGGGTGG - Intergenic
1169536041 20:6541777-6541799 TTTCCTCTGATTGATCTGTCAGG + Intergenic
1169951840 20:11053236-11053258 TTTCCTCTGAGTGACTTGGGTGG - Intergenic
1171261154 20:23735735-23735757 TGTTCTGTGGTTGATGTGAGAGG + Intergenic
1171270281 20:23811577-23811599 TGTTCTGTGGTTGATGTGAGAGG + Intergenic
1173348533 20:42223005-42223027 TGTCCGCTGCTTGATGTGTGGGG + Intronic
1174200685 20:48804566-48804588 TTTCCTCTGGGTGAGGTGGGAGG + Intronic
1174917984 20:54673195-54673217 TGTTCTCTGATTGCTGTGTGTGG - Intergenic
1175656494 20:60775675-60775697 TGCCCTCAGAGTGTTGTGGGAGG - Intergenic
1176594139 21:8675386-8675408 TGTCTTCTCGTTGATGAGGGTGG + Intergenic
1178195895 21:30344708-30344730 TGTTGTCTTATTGATATGGGAGG - Intergenic
1179127552 21:38603820-38603842 TGTCCTCAGATTTTTGGGGGTGG + Intronic
1180276993 22:10652516-10652538 TGTCTTCTCGTTGATGAGGGTGG + Intergenic
1180584216 22:16871425-16871447 TGTCTTCTCGTTGATGAGGGAGG + Intergenic
1183103795 22:35600377-35600399 AGTCCTCTGACAGATGTGGGAGG - Intergenic
1184452788 22:44592754-44592776 TGTCCCCTGAGTGATGGTGGAGG - Intergenic
1185239177 22:49733178-49733200 TTTCCTCTGACTGCTGTGGTTGG + Intergenic
950158047 3:10738760-10738782 TGTCCTCTGTCTGTTGTGCGAGG - Intergenic
951122920 3:18949606-18949628 TTTGCTCTGATTGATGGGGGTGG - Intergenic
951196412 3:19828281-19828303 TGTCCACTGCTTGATGTTTGAGG - Intergenic
952774475 3:37031553-37031575 TGGCCTCTGAATGGTGTAGGTGG - Intronic
953944518 3:47134966-47134988 TAGCCTCTGATTGATATGAGAGG - Intronic
954692610 3:52403666-52403688 TGTACTCTCATTGCTGGGGGTGG + Exonic
958159114 3:89793772-89793794 TGTCCTCTGATTGCAGTTGCTGG + Intergenic
961693713 3:128689204-128689226 TGTCCACTGCTTGATGTGTGGGG + Intergenic
961758405 3:129146023-129146045 TGTCCTTTCATTTATTTGGGTGG - Intronic
963994033 3:151685596-151685618 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
964109278 3:153072557-153072579 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
964277500 3:155023709-155023731 TGTCCTCTGCTTCATGTGTGGGG + Intergenic
966122461 3:176537316-176537338 TGTACTCTGATGGAGGTGGCAGG - Intergenic
967163462 3:186759627-186759649 TGTCCTCTGCTTGGTGTGTGAGG - Intergenic
968551290 4:1224956-1224978 TGTGCTCTGATTTCTGTGTGAGG + Intronic
969483903 4:7461078-7461100 TGTCCTCTGATGTTTGTGGCAGG - Intronic
969500435 4:7549393-7549415 TGGCCTTTTATTGATGTGGTGGG + Intronic
971300720 4:25440498-25440520 TGTCCTCTGATGGACGTAGGCGG - Intergenic
973014032 4:45113386-45113408 TGTCCTCATATTTCTGTGGGAGG + Intergenic
975494909 4:75027033-75027055 TGTTCTCTGATGGATGGGGCAGG - Intronic
975722686 4:77263575-77263597 TTCCATCTGATTGCTGTGGGAGG + Intronic
980692574 4:136314061-136314083 TGTCTACTGTTTGGTGTGGGAGG + Intergenic
981734350 4:147933890-147933912 TGTTCCCTGATTGCAGTGGGAGG + Intronic
985167658 4:187114595-187114617 TGTTCTGTGATTGATGGGAGAGG + Intergenic
986106928 5:4668486-4668508 TGCCCTAGGGTTGATGTGGGAGG + Intergenic
988590905 5:32548581-32548603 TGGCTTCTGATTGATCAGGGTGG - Intronic
989456384 5:41648935-41648957 TTTCCTCTGATTCAGGTGTGGGG + Intergenic
990232451 5:53728023-53728045 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
990334124 5:54755711-54755733 TGTCCTGTGGTAGATGTGTGTGG - Intergenic
990554967 5:56923621-56923643 TGTCCTCTGTTTGATGTCATAGG - Intronic
990866661 5:60387775-60387797 TGTCCACTGCTTGATGTGTGGGG - Intronic
992002998 5:72453315-72453337 TGTCTTGTGATTGACGTGGCTGG - Intronic
993515655 5:88830762-88830784 AGGCCTCTGAGTGATGTGGTAGG + Intronic
994972122 5:106754202-106754224 GGTACTCTGATAGAAGTGGGGGG + Intergenic
995795489 5:115936835-115936857 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
996002248 5:118378227-118378249 TGCCCTCTGCTAGATGTTGGTGG - Intergenic
996700977 5:126450069-126450091 TGTCTTCTGTTTCATGTAGGAGG - Intronic
999990791 5:157047966-157047988 TGTCCACTGCTTGATGTATGGGG + Intronic
1000002412 5:157151589-157151611 TTTACCCTGATTGATTTGGGGGG - Intronic
1001377810 5:171279415-171279437 TGTCATCTAATGGAGGTGGGTGG + Intronic
1002412794 5:179096618-179096640 AGTTCTCTGATTGCAGTGGGAGG + Intergenic
1002613703 5:180437326-180437348 TTTCCTTTGACTGATGGGGGTGG - Intergenic
1005746918 6:28846751-28846773 TGTCTGCTGCTTGATGTGTGGGG + Intergenic
1005879556 6:30045463-30045485 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
1006039071 6:31238810-31238832 TGGCCTCTGGTTGAGATGGGGGG - Intergenic
1007674789 6:43584568-43584590 TGTCTGCTGATTGGTGTGTGGGG - Intronic
1007776955 6:44229227-44229249 TGTCCTCTTATGGGTGTGGGGGG - Intronic
1009978977 6:70703629-70703651 TTTCCTCTAATTGTTTTGGGTGG + Intronic
1010371583 6:75116033-75116055 TGTCCTCTCATTTATTTGGATGG - Exonic
1011312365 6:85993977-85993999 AGTCTTCTGATAGATGTGGGAGG - Intergenic
1014521651 6:122450580-122450602 ATTCCTCTGATAGATCTGGGTGG + Intronic
1015593426 6:134843763-134843785 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
1016343933 6:143090764-143090786 TGGCTGCTGATTGATCTGGGTGG + Intronic
1016704504 6:147090963-147090985 TGTCCTCTGGTTCTTGTGGTTGG - Intergenic
1016750497 6:147626023-147626045 AGTCTTCTGATTGATGGGGCAGG + Intronic
1017672888 6:156783850-156783872 TGTGCTTTGATCCATGTGGGTGG + Intronic
1018475204 6:164133608-164133630 GGTCCTCTGTTTGATTAGGGTGG - Intergenic
1023712434 7:43009265-43009287 TTTCCTCTGCCTGATGTGGGAGG + Intergenic
1025296002 7:57775710-57775732 TTTCCTCAGCTTTATGTGGGAGG + Intergenic
1026624721 7:71981813-71981835 TGTCTGCTGCTTGGTGTGGGAGG + Intronic
1027911611 7:84259373-84259395 TGTTCTCAGAATGAAGTGGGTGG - Intronic
1029383110 7:100226138-100226160 TGTACTCTCATTGCTTTGGGAGG + Intronic
1032594157 7:133222742-133222764 TCTCCTGTGAGTGAAGTGGGGGG + Intergenic
1033258945 7:139825625-139825647 TGTCCACAGGTTGATGTGAGGGG + Intronic
1035652322 8:1277443-1277465 TGACCTGTGATAGATGTGTGGGG + Intergenic
1038848885 8:31255138-31255160 TGTCCACTGCATGATGTGTGGGG - Intergenic
1039015269 8:33141162-33141184 TGTCCTCCCATGGATGTGAGTGG - Intergenic
1039045301 8:33444165-33444187 TGTCCTCAGAGTGGTGAGGGAGG + Intronic
1039416201 8:37396391-37396413 TATCCTCAGCTGGATGTGGGAGG + Intergenic
1039570909 8:38585720-38585742 TGTCATCTGAGGGTTGTGGGAGG - Intergenic
1039804451 8:40986591-40986613 TGTCCACTGCTTGGTGTGTGTGG - Intergenic
1041638873 8:60175268-60175290 TGTACTCTGAATTATGTGAGTGG - Intergenic
1041940511 8:63382145-63382167 TGTTCTCTGCATGCTGTGGGAGG + Intergenic
1044801193 8:95958211-95958233 TCTCCTCTCCTTGATGTGTGGGG - Intergenic
1045565890 8:103314671-103314693 TGTCCTCTAATTGTTGGGTGTGG + Intronic
1047093407 8:121597557-121597579 TGTCCGCTGCTTGGTGTGTGTGG + Intergenic
1047900287 8:129413692-129413714 TGTCCTATCCTTGATATGGGAGG - Intergenic
1049241137 8:141537892-141537914 TGTCCTCGGATGGATGGGGTGGG + Intergenic
1051678716 9:19584433-19584455 TGTGCTCTGATGGATGGTGGAGG + Intronic
1051681687 9:19613922-19613944 TGTCCTCTGAATGATGGAGTAGG + Intronic
1052254310 9:26436161-26436183 TGTGCTCTGAGTGTTGTGTGGGG - Intergenic
1053810630 9:41848406-41848428 AGTCCTCTGATTAATGTGGTAGG - Intergenic
1054619963 9:67339033-67339055 AGTCCTCTGATTAATGTGGTAGG + Intergenic
1056346139 9:85697059-85697081 TGTCCTTTGATTTATGGTGGAGG - Intronic
1059905670 9:118983054-118983076 TGTCCTCTGGTGGAGGTTGGGGG - Intergenic
1060054245 9:120400178-120400200 TGTCCTCTGATTTCTGTGTGTGG - Intronic
1061781599 9:132999564-132999586 TGTCCTTTGAGTGAAGTGGGTGG - Intergenic
1061877209 9:133550252-133550274 AATCCTTTGATTTATGTGGGTGG + Intronic
1062287686 9:135780386-135780408 TGTCCTCTGCCTGGTGTTGGTGG - Intronic
1062479171 9:136743586-136743608 TGTGTTCTGATGGGTGTGGGGGG - Intergenic
1062575856 9:137207372-137207394 TGTTCTCTGATTTCTGTGGATGG - Intronic
1203624274 Un_KI270749v1:155620-155642 TGTCTTCTCGTTGATGAGGGTGG + Intergenic
1185842551 X:3406059-3406081 TGACCTCTATGTGATGTGGGCGG - Intergenic
1187476224 X:19613356-19613378 TGAACTCTGAATGAGGTGGGAGG + Intronic
1190651739 X:52574749-52574771 TCTCCTTTGAGTGTTGTGGGAGG - Intergenic
1192028418 X:67482048-67482070 TGGCTACTGATTGATGAGGGTGG + Intergenic
1195354222 X:104023106-104023128 TGTCCTCTTATTGATGGAGTAGG + Intergenic
1195772755 X:108369738-108369760 TAACCTCTGATTGATGTGTAAGG - Intronic
1196619832 X:117808780-117808802 TGTGCTCTGATGGAGGTGGCAGG - Intergenic
1197129189 X:122984572-122984594 TGGCTGCTGATTGATGAGGGTGG + Intergenic
1198934977 X:141895704-141895726 AGTCCTCTCATTGCTGGGGGAGG + Intronic