ID: 1146403891

View in Genome Browser
Species Human (GRCh38)
Location 17:32520901-32520923
Sequence TCTTCTTTGCAGGCGGTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146403885_1146403891 23 Left 1146403885 17:32520855-32520877 CCAGAATTCAAACTGCACCATAT 0: 1
1: 0
2: 1
3: 20
4: 427
Right 1146403891 17:32520901-32520923 TCTTCTTTGCAGGCGGTATTGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1146403887_1146403891 6 Left 1146403887 17:32520872-32520894 CCATATTCAAAGGTGACTGACAA 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1146403891 17:32520901-32520923 TCTTCTTTGCAGGCGGTATTGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146403891 Original CRISPR TCTTCTTTGCAGGCGGTATT GGG Intronic
903147687 1:21385695-21385717 TCTTCTTTGGAGGCAGAAATTGG + Intergenic
907978678 1:59459350-59459372 CCTTCTTTCAAGGAGGTATTTGG + Intronic
911797297 1:102091054-102091076 ATTTCTTTACAGGCGGTATTGGG + Intergenic
912085801 1:106001793-106001815 TTTTCTTTGAAGGCTGCATTTGG + Intergenic
915863890 1:159477527-159477549 TCATCTTTGCAGTCTGTCTTGGG - Intergenic
918372518 1:183875538-183875560 TCTTCTAAGCAGGTGTTATTAGG + Intronic
920727874 1:208453881-208453903 GCTTCTTTGCAGAAGATATTGGG - Intergenic
921260543 1:213382152-213382174 TCTTATTTGCTGGAGGTTTTAGG - Intergenic
921333367 1:214062745-214062767 TCTGCATGGCAGGCAGTATTTGG + Intergenic
924807884 1:247375729-247375751 TGTTCTTTGCAGGAGTAATTAGG - Intergenic
1066175676 10:32902753-32902775 ACTTCATTGCAGACTGTATTTGG + Intronic
1067353016 10:45494283-45494305 TCTACTTTCCAGGGTGTATTTGG - Intronic
1067839666 10:49665776-49665798 TCTGCTTAGCAGGCGGCATCAGG + Intergenic
1073178048 10:101568587-101568609 TCTCCTTTGCAGGCAGAGTTGGG + Intergenic
1075382386 10:122029877-122029899 TCTTGTTTGCAGCCAGTAGTGGG - Intronic
1076561214 10:131365820-131365842 TCTTCTTTACACTCGGAATTGGG + Intergenic
1077624985 11:3763029-3763051 ACTTCTTTGCAGGGATTATTTGG - Exonic
1078857972 11:15221750-15221772 TCATCTATGCAGGAGATATTTGG - Intronic
1085668043 11:78433380-78433402 TCTTATTTTCAGGTGGCATTTGG + Intergenic
1089734083 11:120537743-120537765 TCTACTTTGCAGGTGGCACTGGG - Intronic
1089739490 11:120572500-120572522 TCTCCTTCGCAGGCTGTCTTTGG + Intronic
1091123496 11:133076414-133076436 TTTTCTTTGCAGGTGGAAGTGGG - Intronic
1091932809 12:4410347-4410369 TCTTATCTGCAGGAGATATTGGG + Intergenic
1092586699 12:9908017-9908039 ATTTCTTTACAGGCAGTATTGGG + Intronic
1092623822 12:10303753-10303775 TCTTATATGCAGGGGCTATTTGG - Intergenic
1095868970 12:47004626-47004648 ACTTCTTTGAGGGCTGTATTAGG - Intergenic
1101244556 12:102873225-102873247 TCTTCTTTGCAGTTAGTAGTGGG + Intronic
1119972555 14:78988024-78988046 TCTTCCTGGCAGGTGGTACTGGG - Exonic
1127676206 15:61241780-61241802 TCTTCTCTGGAGGCAGTGTTGGG - Intergenic
1128758587 15:70199412-70199434 TCTTTTTTGCAAGGGGTATTGGG - Intergenic
1129131210 15:73498303-73498325 TCCTCTTTGCTGTAGGTATTTGG + Intronic
1130773700 15:86953377-86953399 TCTTCTTGGTAAGCTGTATTTGG + Intronic
1133747331 16:8697142-8697164 TGTTCTGAGCAGGTGGTATTTGG + Intronic
1139218630 16:65155554-65155576 ACTTCTTTGAAGCCTGTATTAGG + Intergenic
1139538510 16:67595550-67595572 TCTTCTTGGCTGGCGGTATAAGG + Intronic
1143663882 17:8345107-8345129 TCTTCTTTGGGGGTGGTATGAGG + Intronic
1145251054 17:21297272-21297294 TCTTCTTGGCAGGCGGCAGCAGG + Intronic
1145413424 17:22693659-22693681 TCTTGTTCACAGGCAGTATTTGG + Intergenic
1146403891 17:32520901-32520923 TCTTCTTTGCAGGCGGTATTGGG + Intronic
1146764601 17:35507943-35507965 TCTTCTTTGGAGGCAGAAATTGG - Intronic
1148567371 17:48641692-48641714 TCTTCTTAGCACGCGGGTTTTGG - Intergenic
1148727680 17:49806834-49806856 TCTTCTTTGCAAGGGGCATTAGG + Intronic
1151506155 17:74528812-74528834 TCTACTTTGAAGGTGGTAATAGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155312903 18:24541849-24541871 TGTTCTTTGCTGGAGGTATGGGG + Intergenic
1155904419 18:31431836-31431858 TCTTCTTTGCAAGAAGTATTTGG - Intergenic
1158058545 18:53311852-53311874 TTTTCTATTCAGGCAGTATTAGG - Intronic
1160696118 19:485353-485375 TGTTCTGGGCAGGCGGTGTTTGG - Intergenic
1162675605 19:12295745-12295767 TCTTCTTTGGAGGCAGAAATTGG - Intergenic
1164683947 19:30154773-30154795 TCATTTTTGCACGCGGTATCAGG + Intergenic
936419961 2:112353946-112353968 TCTTCTTTGGAGGCAGAAATTGG + Intergenic
938798909 2:134741957-134741979 TCTTCTTTTCCTGCTGTATTTGG - Intergenic
939324050 2:140664440-140664462 TCTTTTTTGGAGGGTGTATTTGG - Intronic
1171244527 20:23600875-23600897 TCTTCATTGCACGCTGAATTGGG - Intergenic
1178785457 21:35649285-35649307 TCTTCTCTGCAGTCAGTGTTTGG - Intronic
1181865708 22:25853332-25853354 TCTTCTTTGCAGTGGGTACCAGG + Intronic
1182567895 22:31213175-31213197 TCTTCCTTCCAGGAGGTGTTTGG - Intronic
949205470 3:1433097-1433119 TCTTCATTGCAGGAAGTCTTTGG - Intergenic
949257802 3:2069805-2069827 TCTGCTTAGCAGGCAATATTTGG + Intergenic
950726732 3:14921780-14921802 TCTTCTTTGCTGGTGGTTCTGGG + Intronic
952507856 3:34024005-34024027 GCTTCTTTGAAGACTGTATTTGG + Intergenic
957573622 3:81981256-81981278 TCTTCTTTACAGGTAGTATATGG + Intergenic
959388059 3:105737659-105737681 TTTTCTTTCCATGTGGTATTAGG - Intronic
964009766 3:151877946-151877968 TGTTCTTTGCAGGCACTTTTGGG - Intronic
968674992 4:1872086-1872108 TTTTGTTTGCAGGCGGTGTCTGG + Intronic
973206559 4:47567028-47567050 TCTTCTTTTCATGGGCTATTTGG - Intronic
977709826 4:100112300-100112322 TCTTCTTTGGAGGCAGAAATTGG - Intergenic
978294115 4:107183195-107183217 TATTCTATGCAGGCTCTATTAGG - Intronic
981643317 4:146969603-146969625 TCTTCTTTGCAGGAAGAATGGGG - Intergenic
985500130 5:238398-238420 TTTTTTTTGCAGGGGGTTTTGGG - Intronic
987361000 5:17106366-17106388 TCTTCTTTGCAGCTGGAAATGGG + Intronic
988932492 5:36050283-36050305 TATTCTCTGCAGGCATTATTGGG - Intronic
990973815 5:61539584-61539606 TGTTCATTGCAGGCGATGTTCGG + Exonic
1002076002 5:176708881-176708903 GCTTCCTTGCAGGGGGTAATGGG + Intergenic
1003905034 6:10691603-10691625 TCTTCTTTGGAGGCAGAAATTGG + Intronic
1007197546 6:40075676-40075698 TCTCCTTTGAAGTCAGTATTTGG - Intergenic
1016026170 6:139289105-139289127 TCTTCTTTGGAGGCAGAAATTGG - Intronic
1021057528 7:16068124-16068146 TCTTCTTCAGAGGCGATATTGGG + Intergenic
1021893191 7:25207678-25207700 TTTTCTTTCCAGGCCCTATTAGG - Intergenic
1022763810 7:33386879-33386901 TCTTCTTTGGAGGCAGTGTTTGG + Intronic
1023635891 7:42209922-42209944 TCTCCTTTACAGGGAGTATTTGG - Intronic
1024490949 7:49985627-49985649 TTTTTTTTGCATGGGGTATTAGG - Intronic
1025710683 7:63905469-63905491 TCTTCTTTGGAGGCAGAAATTGG + Intergenic
1030201189 7:106906873-106906895 TCTTCTTTGCAGCCAGGCTTAGG - Exonic
1030773209 7:113500288-113500310 TCTTCTTTTGAGGCAGTATGTGG + Intergenic
1035811423 8:2494881-2494903 TATTCTTTGTATGTGGTATTGGG - Intergenic
1051504546 9:17813092-17813114 TTTTCTTTGCAGGCGCCACTGGG - Intergenic
1052487243 9:29118146-29118168 TCTTCATTGCTGTTGGTATTTGG + Intergenic
1052490785 9:29164257-29164279 TCTTCTATTTAGGCAGTATTTGG - Intergenic
1057023689 9:91719892-91719914 CCTTCTTTGCAGCTGGTATCAGG + Intronic
1057499022 9:95582091-95582113 TCCCCTTTGCAGGGGGGATTAGG - Intergenic
1059535894 9:115080501-115080523 TCTTCTTGGCAGGGGGTTGTTGG - Intronic
1061986616 9:134133856-134133878 TCTTCCTTGCTGGCGTTATATGG - Intergenic
1185974603 X:4706172-4706194 GCTTCTTTGATGGTGGTATTAGG - Intergenic
1193667186 X:84335503-84335525 TCTCCTTTGCAGCAGATATTTGG - Intronic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1198884548 X:141320006-141320028 TCATCGTTGCAGGGGATATTTGG - Intergenic