ID: 1146404858

View in Genome Browser
Species Human (GRCh38)
Location 17:32528280-32528302
Sequence CCTTGCTACCAGCTCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 135}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146404858_1146404868 25 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404868 17:32528328-32528350 TGGGAGAGGGTGAGATGGGTAGG 0: 1
1: 1
2: 10
3: 107
4: 891
1146404858_1146404865 12 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404865 17:32528315-32528337 ACTGCTTTGCAGGTGGGAGAGGG 0: 1
1: 1
2: 3
3: 53
4: 719
1146404858_1146404861 2 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404861 17:32528305-32528327 CTGAGGAATTACTGCTTTGCAGG 0: 1
1: 0
2: 0
3: 13
4: 164
1146404858_1146404863 6 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404863 17:32528309-32528331 GGAATTACTGCTTTGCAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1146404858_1146404864 11 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404864 17:32528314-32528336 TACTGCTTTGCAGGTGGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 271
1146404858_1146404867 21 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404867 17:32528324-32528346 CAGGTGGGAGAGGGTGAGATGGG 0: 1
1: 2
2: 3
3: 60
4: 754
1146404858_1146404862 5 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404862 17:32528308-32528330 AGGAATTACTGCTTTGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 173
1146404858_1146404866 20 Left 1146404858 17:32528280-32528302 CCTTTGGAGAGCTGGTAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1146404866 17:32528323-32528345 GCAGGTGGGAGAGGGTGAGATGG 0: 1
1: 0
2: 14
3: 171
4: 1496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146404858 Original CRISPR CCTTGCTACCAGCTCTCCAA AGG (reversed) Intronic
900420199 1:2552976-2552998 CCTGGGTTCCAGCCCTCCAAGGG - Intergenic
900424232 1:2568682-2568704 CCTGGGTTCCAGCCCTCCAAGGG + Intergenic
900679102 1:3906533-3906555 CCTTGCTGCCAGCCCTCCGCTGG + Intergenic
901208598 1:7511687-7511709 TCTTGCTGCCAGATCTCAAAAGG + Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
904365832 1:30010461-30010483 GCCTGCTCCCAGCTCTCCAAGGG + Intergenic
904819824 1:33234749-33234771 CATTGCTCCCATCTGTCCAATGG + Intergenic
905244304 1:36602161-36602183 CCTTGCTTCCAGCCTTCCTAGGG - Intergenic
905511823 1:38527832-38527854 CCTTGCTGTGAGCTGTCCAATGG + Intergenic
905887687 1:41500500-41500522 CCTTCCTACCTGCTCTCCCTGGG - Intergenic
906279397 1:44543056-44543078 CCTTCTTCCCAGCTCTCCGATGG - Intronic
909186526 1:72493549-72493571 CCTTTCTACAAGCACACCAAAGG - Intergenic
909476109 1:76082467-76082489 CCTTGTTAGCAGCTCTGTAAAGG + Intronic
910607089 1:89098990-89099012 CCCCGCTGCTAGCTCTCCAAAGG + Intergenic
911175132 1:94810956-94810978 CCTTGCTCCCTGCTCTTCAGAGG + Intergenic
912545584 1:110448878-110448900 CCCTGCTCCAAACTCTCCAAGGG + Intergenic
915466758 1:156102851-156102873 GCTTGGGCCCAGCTCTCCAAGGG + Intronic
915561904 1:156692641-156692663 CCTTCCTACCATCTTTCCCAGGG - Intergenic
916174103 1:162023647-162023669 CCTTGCGTCCGGCTCTCCACTGG - Exonic
919728103 1:200896780-200896802 CTTTGTTACCAGCTTTCCCAAGG + Intronic
921846130 1:219884167-219884189 CCCAGCTGCCAGATCTCCAAAGG + Intronic
923141550 1:231164083-231164105 ACTTTCTGTCAGCTCTCCAAGGG - Intronic
923351199 1:233108624-233108646 CCCTTCTGCCAACTCTCCAATGG + Intronic
923465468 1:234244351-234244373 CCTTTCTACCAGCACCCCACCGG - Intronic
1064993043 10:21273305-21273327 CTTGGAGACCAGCTCTCCAAGGG - Intergenic
1071294592 10:84210638-84210660 CCTTGTTGCCACCTGTCCAAAGG - Intronic
1073427841 10:103466832-103466854 CCCTGGTACCAGCTCTCACATGG - Intergenic
1076078379 10:127555824-127555846 CCTTCCTACCAGCTTTTCATCGG - Intergenic
1076148571 10:128144755-128144777 CCCTGCCACCAGCTCTCAACAGG - Intergenic
1078193101 11:9109725-9109747 TCTTGCTACCATGACTCCAAAGG + Intronic
1079279722 11:19076404-19076426 CCTTGCTTAGAACTCTCCAATGG - Intergenic
1080034505 11:27699032-27699054 CCCTCCTACCAGCTCTCTAAGGG + Intronic
1080613327 11:33924426-33924448 CTTTACTTTCAGCTCTCCAAAGG + Intergenic
1085842428 11:80028006-80028028 CCTTTCTCCAGGCTCTCCAAAGG + Intergenic
1092355057 12:7787812-7787834 GCTTGCCCGCAGCTCTCCAAAGG - Intronic
1093793547 12:23284538-23284560 CCTTGTTCCCAGTTCTCAAAGGG - Intergenic
1094222662 12:28011052-28011074 CATTTCTACCATCTCCCCAAGGG + Intergenic
1105496693 13:20936679-20936701 CCTTGCTGCCAGCTTTGCACAGG - Intergenic
1106165897 13:27246098-27246120 CCTTGCTTACAGCCCTCCACAGG - Intergenic
1107131372 13:36899924-36899946 CCCTGCTCCAATCTCTCCAAAGG + Intronic
1112202782 13:97293002-97293024 CTTAGCTACCAGTTCTACAAAGG + Intronic
1115974623 14:38982783-38982805 CCTTGCTGCCACCTCACTAAGGG - Intergenic
1119541804 14:75443749-75443771 CCTCACCACCACCTCTCCAAGGG - Intronic
1119748641 14:77062230-77062252 CCTTGCTAGCACCGATCCAAGGG - Intergenic
1120720222 14:87882508-87882530 CCTTGCTTAAAGCCCTCCAATGG + Intronic
1121105294 14:91275341-91275363 CCTGCCTGCCAGATCTCCAAAGG + Intronic
1121892023 14:97603282-97603304 CTTTGCAATCAGCTCCCCAAAGG + Intergenic
1122625943 14:103085389-103085411 CCTTGCTGCCAGGGCTCCAGTGG + Intergenic
1123197437 14:106629942-106629964 CCTTCCCAACAGCTCCCCAAAGG - Intergenic
1123198777 14:106641818-106641840 CCTTCCCAACAGCTCCCCAAAGG - Intergenic
1125588105 15:40836258-40836280 CCTTGCTTCCACCACACCAAGGG + Intergenic
1126598456 15:50405017-50405039 CCTTGCTAACAACCCTTCAAAGG + Intergenic
1128222359 15:65978267-65978289 CCTTGGTCCCAGCTCTCCCTGGG + Intronic
1129054847 15:72811879-72811901 TCTCTCTACCAGCTCTCCTAGGG + Intergenic
1130378346 15:83350502-83350524 CCTTGCCACCAACTTGCCAAGGG + Intergenic
1137719012 16:50616817-50616839 CCTTTCTGCCATCTGTCCAAAGG + Intronic
1137893638 16:52187586-52187608 CTCTGCTACCTGCTCTTCAAGGG + Intergenic
1142004066 16:87680698-87680720 CCTGGCACCCAGTTCTCCAAGGG - Intronic
1142007454 16:87696291-87696313 CCTGAGTACCAGCTCTCCCAGGG - Intronic
1143376334 17:6469759-6469781 CCTTGCTCACAGCCCTGCAATGG + Intronic
1143463970 17:7123303-7123325 GCTGGCAACCAGCTCTCCCACGG - Intergenic
1143847324 17:9782484-9782506 TCTTGCCTCCAGCTCTGCAATGG - Intronic
1146404858 17:32528280-32528302 CCTTGCTACCAGCTCTCCAAAGG - Intronic
1150416405 17:64992342-64992364 CCTGGCCACCCACTCTCCAAGGG + Intergenic
1152820708 17:82436311-82436333 CCTGGCTCCCAGCTCTGCTATGG - Intronic
1157315198 18:46581044-46581066 CCTTGCTTGAAGCCCTCCAATGG - Intronic
1157612826 18:48969002-48969024 CATTGCTACCCTCACTCCAAGGG - Intergenic
1159375757 18:67590727-67590749 GCTTGCCAACACCTCTCCAAAGG + Intergenic
1164598987 19:29548629-29548651 CCTGGCTCCCAGCTCTCCCCTGG - Intronic
926350548 2:11989987-11990009 TCTTTCAACCAGCTGTCCAATGG - Intergenic
928282705 2:29963396-29963418 TCTTTCTACCAGTTCTCCAGAGG + Intergenic
928448487 2:31354818-31354840 CTTTTCTTCCAGATCTCCAATGG - Intronic
928591173 2:32816849-32816871 CCATGCTACCAAGTCCCCAATGG - Intronic
929811761 2:45194712-45194734 CTTTCCTCCCAGCTCTCCATGGG - Intergenic
932414345 2:71564706-71564728 ACATGCTCCCAGCTCTCCAGTGG - Intronic
933628967 2:84634955-84634977 CATTGTGACCAGATCTCCAAAGG - Intronic
933750830 2:85601426-85601448 CCTTCATACCAGTTCTCCACAGG + Exonic
933772240 2:85751945-85751967 CTTTGCTCCCAGGTCTCCCACGG - Intronic
935322843 2:101905792-101905814 CCTTTCTACCACGTCTCAAATGG + Intergenic
938259813 2:129887641-129887663 CCTTGCAACTATCTCTCCTATGG + Intergenic
938634667 2:133210901-133210923 CCTTGTTAGAAGCCCTCCAATGG + Intronic
939833760 2:147103367-147103389 CCTCTCTCTCAGCTCTCCAAAGG - Intergenic
939938572 2:148321921-148321943 CCTTTCTCCAAGCTCTCCAATGG + Intronic
940065979 2:149629879-149629901 CCTTTCCATCAGCTTTCCAAGGG + Intergenic
941749420 2:169119357-169119379 GCTTCCTGCCAGCTCCCCAATGG - Intergenic
942720008 2:178940832-178940854 CCTTTCAACCAGCTCTGGAAAGG + Intronic
942869793 2:180721115-180721137 ACTTTATACCAGCTCTACAAAGG + Intergenic
942893896 2:181026534-181026556 CCTTGATACATGCTTTCCAAAGG + Intronic
942926088 2:181434108-181434130 CCCTGCTACAAACCCTCCAACGG - Intergenic
946138162 2:217665129-217665151 CCTTGCAACAAGTTCTCAAAGGG + Intronic
1174461684 20:50687498-50687520 TTTAGCAACCAGCTCTCCAAGGG + Intronic
1177417385 21:20812277-20812299 CATATCTACCAGTTCTCCAAGGG - Intergenic
1178924678 21:36764879-36764901 CTTTGCTGCCAGCTGTGCAAAGG + Intronic
1181650570 22:24256854-24256876 CCTTTCTACCACCTCTGCATGGG - Intergenic
951408209 3:22327208-22327230 CCTGGCTACCAGTTTTCGAATGG - Intronic
954595436 3:51820132-51820154 CCCTGCTGCCTGCTCTCCTAGGG + Intronic
955359268 3:58258938-58258960 TCCTGCTACCAGCACTGCAAGGG - Intronic
959289748 3:104458813-104458835 CCTAGCTTCCAGCCCTGCAATGG + Intergenic
961536811 3:127575670-127575692 CCCAGCTACCAGCTCTACAGTGG + Intronic
962872528 3:139510005-139510027 CCTGCCAACCAGCTCTGCAAGGG + Intergenic
965596715 3:170418477-170418499 CCCTGCTGCGAGCACTCCAAGGG - Intergenic
966766403 3:183466725-183466747 ATTTGTTTCCAGCTCTCCAAGGG + Intergenic
968445299 4:649463-649485 CCTAGCGACCAGGCCTCCAAGGG + Intronic
970340496 4:15101409-15101431 CCTTGGTTTCAGCTCTCCAGTGG + Intergenic
971290253 4:25331097-25331119 CTGTGCTGCCAGCTCTCCACAGG + Intronic
973716512 4:53682190-53682212 GCTTGCTACCTCTTCTCCAATGG + Intronic
973852784 4:54977587-54977609 CCTAGGTACCAGCTCTGCCAAGG + Intergenic
980060641 4:128125422-128125444 GCTTCCTACCTGCTCCCCAAGGG + Intronic
985937585 5:3108632-3108654 GCTTGCTAGCAGCTCCCCATGGG + Intergenic
986516121 5:8565629-8565651 GCTTGCAAGCAGCTCTCCAGCGG - Intergenic
990861083 5:60328300-60328322 CCATTCTTCTAGCTCTCCAAGGG + Intronic
994866938 5:105285854-105285876 CCATGCTACCAGTATTCCAATGG + Intergenic
1000861426 5:166460507-166460529 TCTTGCTACCTGCTCTCAGATGG - Intergenic
1001517289 5:172364870-172364892 CTTAACTACCAGCTCTCCAGTGG - Intronic
1001997062 5:176170670-176170692 CCTTCCTGCCAGCACTCAAATGG - Intergenic
1009376294 6:62974693-62974715 CCTTGCTACAAAGTTTCCAAAGG - Intergenic
1010671613 6:78693268-78693290 TCTTGCTAGCAGCTCTCCTGGGG + Intergenic
1011498990 6:87967174-87967196 CCCTGCTTTCAGGTCTCCAAAGG + Intergenic
1016914140 6:149229020-149229042 CTTTGCTGCCATCTTTCCAATGG - Intronic
1017194696 6:151686817-151686839 CCTTATTACCAGGTATCCAAGGG - Intronic
1019085885 6:169476302-169476324 CCTTGCTCCTTGCTCTCCCAGGG + Intronic
1021870709 7:25003429-25003451 CCCTGCTTCCAGCTCTCTCATGG + Intergenic
1022984215 7:35634735-35634757 CCCTGCTCCCTTCTCTCCAAGGG - Intronic
1024968927 7:55051102-55051124 CCTTACCAACAGCTCTCCCATGG - Intronic
1028240208 7:88410587-88410609 CTGTGCTACCTGCACTCCAATGG - Intergenic
1033520752 7:142158055-142158077 CCTTGCTACCGTCTCTCCCCGGG - Intronic
1034957459 7:155343941-155343963 CCTTTCTCCCACCTCACCAATGG + Intergenic
1036733743 8:11288739-11288761 CCTAGCTTTCACCTCTCCAAGGG - Intronic
1037332053 8:17752705-17752727 TCTTGCCACGAGCCCTCCAAGGG + Intronic
1038594437 8:28874221-28874243 CCTTGGTCCCAGATTTCCAAAGG + Intronic
1040834825 8:51720805-51720827 TCTTGCTGCCAGCTCCCCACTGG + Intronic
1050667045 9:7950634-7950656 GCTTGCTTCCAGCCCACCAAAGG - Intergenic
1052040956 9:23738505-23738527 CATTTCTACCAGCTTCCCAAAGG + Intronic
1055917362 9:81418795-81418817 ACTTGCTAAAAGCTCTCCATAGG + Intergenic
1056822710 9:89854755-89854777 ACTTCCTACCAGCTCTGCAAAGG + Intergenic
1062043348 9:134414259-134414281 CCTTGCTGCCAGTTCTCCCCAGG - Intronic
1185777903 X:2820417-2820439 CCTTCCCACCAGCTCTGCTATGG - Intergenic
1189127519 X:38463794-38463816 CCATGCTACCAGCTTCCCTAGGG - Intronic
1190817836 X:53944306-53944328 CCTACCTCCAAGCTCTCCAAAGG + Intronic
1193162868 X:78247382-78247404 CCTTTCTACCATTTCTACAATGG - Intergenic