ID: 1146407399

View in Genome Browser
Species Human (GRCh38)
Location 17:32550943-32550965
Sequence GACACTCTGTTGCCTAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146407399 Original CRISPR GACACTCTGTTGCCTAGGGC TGG (reversed) Intronic
901986917 1:13082868-13082890 CTCACTCTGTTGCCTAGGCTGGG - Intergenic
901994895 1:13143899-13143921 CTCACTCTGTTGCCTAGGCTGGG + Intergenic
903186736 1:21633467-21633489 GAAACTCTGGTGGCCAGGGCAGG + Intronic
903240428 1:21979015-21979037 CTCACTCTGTTGCCCAGGGCTGG - Intronic
903244167 1:22003649-22003671 CTCACTCTGTTGCCCGGGGCTGG - Intronic
903498561 1:23788900-23788922 CTCACTCTGTTGCCTCAGGCTGG - Intergenic
903507142 1:23845355-23845377 GTCACCCTGTTGCCTATGGGAGG - Exonic
904080642 1:27870578-27870600 CTCACTCTGTTGCCTAGGCTGGG + Intergenic
904141083 1:28353711-28353733 GACTCTCTGTTGCCCAGGCTGGG + Intergenic
904298783 1:29540975-29540997 GACAGGCTCTGGCCTAGGGCAGG - Intergenic
904319777 1:29689391-29689413 GAGACTCTGTTGCTCAGAGCTGG + Intergenic
904478118 1:30777491-30777513 GCCACTCTGGGGCCCAGGGCAGG + Intergenic
904651358 1:32008355-32008377 GAAACTCTCCTGCCCAGGGCTGG + Intergenic
905031323 1:34886024-34886046 GGCGCTCTCCTGCCTAGGGCCGG + Intronic
905522636 1:38612268-38612290 GCCACTCTGTGGCCAAGGACTGG + Intergenic
906648863 1:47496137-47496159 GTCACTCTGTTGCCCCAGGCTGG + Intergenic
907321799 1:53607299-53607321 CTCACTCTGTTGCCTAGGCCAGG + Intronic
909624262 1:77698528-77698550 CTCGCTCTGTTGCCAAGGGCTGG + Intronic
909847684 1:80416590-80416612 CTCACTCTGTTACCTAGGCCCGG + Intergenic
912387324 1:109278065-109278087 GACACTTTGGTGCCTAAGTCAGG + Intergenic
914432323 1:147630153-147630175 GACATGCAGTTTCCTAGGGCTGG - Intronic
915536300 1:156537925-156537947 CTCACTCTGTTGCCTAGAGCTGG + Intronic
916001156 1:160617123-160617145 TTCACTCTGTTGCCTAGGCTGGG - Intronic
916219367 1:162428245-162428267 GTCACTCTGTTGCCCAGGCTGGG - Intergenic
916540862 1:165752762-165752784 CTCACTCTGTCGCCTGGGGCAGG - Intronic
916720498 1:167481852-167481874 GACACACTGAGGCCCAGGGCAGG + Intronic
920176947 1:204107886-204107908 GTCAGTCTGTTCACTAGGGCTGG - Intronic
920276952 1:204813611-204813633 GTCACTATGGTGCCTAGGACTGG - Intergenic
920354871 1:205364563-205364585 CTCACTCTGTTGCCAAGGCCAGG + Intergenic
922235605 1:223720343-223720365 CTCACTCTGTTCCCCAGGGCTGG + Intronic
922508352 1:226140776-226140798 GGCACTCTGTTGCCCAGGCTGGG + Intergenic
923120348 1:230984218-230984240 CTCACTCTGTCGCCTAGGCCTGG - Intronic
923402631 1:233629649-233629671 GGCACTCTGTTGCCTAACTCCGG - Intronic
923864315 1:237922575-237922597 CTCACTCTGTTGCCCAAGGCTGG - Intergenic
1066392962 10:34993555-34993577 CTCACTCTGTTGCCCAGGCCTGG - Intergenic
1068953476 10:62801670-62801692 CTCACTCTGTTGCCTAGGCCTGG + Intergenic
1069417982 10:68218768-68218790 CTCACTGTGTTGCCCAGGGCTGG + Intergenic
1069845515 10:71368197-71368219 GATACTCTGTTGCCCAGGCTGGG - Intergenic
1071514746 10:86289741-86289763 GACACTCTGTTTCGTTGGGGTGG - Intronic
1072353720 10:94585429-94585451 CTCACTCTGTTGCCCAGGCCTGG + Intronic
1072508157 10:96090661-96090683 GGCACTCTGTTGCCCAGAGAGGG + Intergenic
1073296276 10:102440995-102441017 CTCACTCTGTTGCCCAGGGCTGG - Intergenic
1073377396 10:103048243-103048265 CTCACTCTGTTGCCCAGGCCTGG + Intronic
1073958306 10:108897314-108897336 CACACTCTGTTGCCCAGGCTGGG + Intergenic
1074010195 10:109470803-109470825 GAATCTCTGTGACCTAGGGCAGG + Intergenic
1075324021 10:121515558-121515580 GACACCCAGTTGCACAGGGCAGG + Intronic
1077183208 11:1225511-1225533 GACACACTGTGGCCAAGGCCGGG - Intronic
1078063103 11:8061023-8061045 GGCACCCTGATGCCTGGGGCTGG - Intronic
1078128822 11:8594676-8594698 GACCCTCTGTTGCATGGGGCAGG - Intergenic
1078203841 11:9210572-9210594 CACACTCTGTTGCCCAGGCTGGG + Intronic
1078682002 11:13486098-13486120 GTAACTTTGTGGCCTAGGGCTGG + Intergenic
1079080261 11:17408982-17409004 CTCACTCTGTTGCCTAGGCTGGG + Intronic
1080681377 11:34479656-34479678 CTCACTATGTTGCCCAGGGCTGG - Exonic
1083342806 11:61969190-61969212 GAAAATATGTTGCCTGGGGCTGG + Intergenic
1085437228 11:76518198-76518220 ATCACTCTGTTGCCCAGGCCAGG + Intronic
1085677448 11:78537599-78537621 CTCACTATGTTGCCCAGGGCTGG - Intronic
1089618579 11:119709385-119709407 GCCACTCTGCTACCTGGGGCCGG + Intronic
1090337958 11:125986733-125986755 CTCACTCTGTCGCCCAGGGCTGG - Intronic
1091716727 12:2783010-2783032 GACAACTTGTTGCCTAGGGCTGG + Intergenic
1091807248 12:3365580-3365602 GACTCTGTGTTGCGTGGGGCAGG + Intergenic
1092733149 12:11553320-11553342 CTCACTATGTTGCCTGGGGCTGG + Intergenic
1093437017 12:19147764-19147786 CTCACTCTGTTGCCCAAGGCTGG + Intronic
1093455009 12:19356481-19356503 GTCACTCTGCTGCCTAGGCTGGG - Intronic
1094685975 12:32715121-32715143 CTCACTCTGTTGCCCAGGCCTGG + Intronic
1094843730 12:34352476-34352498 GCCTCCCTGTTGCCTTGGGCTGG + Intergenic
1094851159 12:34382978-34383000 GACTTCCTGTTGCCTTGGGCTGG + Intergenic
1095381321 12:41596721-41596743 GATAAGTTGTTGCCTAGGGCTGG - Intergenic
1096338756 12:50778774-50778796 GAAACCATGTTGCCCAGGGCTGG + Intronic
1096357887 12:50957853-50957875 CTCACTCTGTTGCCCAAGGCTGG - Intronic
1096669261 12:53188733-53188755 CACACTCTGTTGGGTAGGGATGG - Exonic
1098127626 12:67316950-67316972 CTCACTATGTTGCCTAGAGCTGG - Exonic
1098351658 12:69568489-69568511 GACATTATGTTGCCCAAGGCTGG - Intronic
1099309995 12:81007132-81007154 GTCACTCTGTTGCCCAGGCAGGG + Intronic
1100519819 12:95363120-95363142 CTCATTCTGTTGCCCAGGGCTGG - Intergenic
1101096878 12:101351155-101351177 CTCACTCTGTCGCCTAGGGTGGG + Intronic
1101754420 12:107609784-107609806 CACACTGTGTAGCCTTGGGCAGG + Intronic
1102276941 12:111589739-111589761 TTCACTCTGTTGCCTAGGGTGGG - Intronic
1102844931 12:116170629-116170651 GTCACTCTGTTGCCCAGGCTAGG + Intronic
1103097494 12:118143873-118143895 CTCACTCTGTTGCCTAGGCGTGG - Intronic
1104581648 12:130015288-130015310 CTCACTCTGTTGCCCAAGGCTGG + Intergenic
1105305088 13:19162719-19162741 CTCACTCTGTTGCCCAGGCCAGG - Intergenic
1105637216 13:22227234-22227256 AACACTCAGTTGCCCATGGCAGG - Intergenic
1106961730 13:35006776-35006798 CTCACTCTGTTGCCCAGGCCAGG + Intronic
1108325562 13:49327413-49327435 GATACTCAGTGGGCTAGGGCAGG - Intronic
1112411812 13:99171147-99171169 CTCACTCTGTTGCCTAGGCTGGG + Intergenic
1114604067 14:23981970-23981992 GACACTCAGTTCCCAGGGGCAGG + Intronic
1114609090 14:24024767-24024789 GACACTCAGTTCCCAGGGGCAGG + Intergenic
1116314904 14:43374244-43374266 AACACTATGTTGACTAGGACTGG - Intergenic
1116736762 14:48701249-48701271 AACACTATGTTGACTAGGACTGG - Intergenic
1116746725 14:48830002-48830024 CTCACTCTGTGGCCTAGGGCTGG - Intergenic
1117505782 14:56401481-56401503 TTCACTCTGTTGCCAAAGGCAGG - Intergenic
1118200322 14:63665282-63665304 CTCACTCTGTTGCCCAGGCCGGG - Intergenic
1119499901 14:75116405-75116427 CTCACTCTGTTGCCCAGGCCTGG - Intronic
1119989651 14:79181649-79181671 CACACTCTGTTGCCCAGGACTGG - Intronic
1120706747 14:87753407-87753429 GTCACTCTGTTCCCCAAGGCTGG - Intergenic
1121138681 14:91521772-91521794 CTCACTCTGTTGCCTAGGCTAGG + Intergenic
1121180300 14:91923912-91923934 GACACTTTGTTGGCTCTGGCTGG - Intronic
1121469171 14:94138720-94138742 GATACTCTGCAGCCTGGGGCAGG + Intergenic
1121757862 14:96418291-96418313 CTCACTCTGTTGCCCAGGGTGGG - Intronic
1122245194 14:100397708-100397730 CACACTCTGTTCCCTTGGCCTGG - Intronic
1123038160 14:105479644-105479666 GAGCCGCTGTAGCCTAGGGCTGG - Exonic
1124469441 15:29969620-29969642 CTCACTGTGTTGCCCAGGGCTGG - Intergenic
1127242274 15:57129520-57129542 TTTACTCTGTTGCCTAGGGTTGG - Intronic
1127496566 15:59518352-59518374 CTCACTCTGTTGCCTAGGCCGGG + Intronic
1127851724 15:62919143-62919165 GACTAGCAGTTGCCTAGGGCTGG + Intergenic
1128199713 15:65793883-65793905 CTCACTATGTTGCCTAAGGCCGG + Intronic
1129600806 15:76996952-76996974 GCCACTCTGTAGCCCAGGGCAGG + Intronic
1132252467 15:100343986-100344008 GACACTCTCCTACCTAGGGGTGG + Intergenic
1132353145 15:101153026-101153048 GAGACGCCGTTGCCTAGAGCTGG - Intergenic
1132982983 16:2748733-2748755 CTCACTATGTTGCCCAGGGCTGG + Intergenic
1133229021 16:4357727-4357749 CACACTGTGGTGTCTAGGGCAGG - Intronic
1134483506 16:14638351-14638373 CTCACTCTGTTGCCCAGGCCTGG - Intronic
1136039461 16:27566504-27566526 CTCACTCTGTCGCCTGGGGCTGG - Intronic
1137476379 16:48812943-48812965 GACACTTTGCTGCCAATGGCCGG + Intergenic
1137823295 16:51465936-51465958 CTCACTCTGTTGCCCAGGCCTGG + Intergenic
1139441409 16:66969600-66969622 AACACTCTCTTGCCCAGGGCTGG + Intronic
1139716132 16:68814515-68814537 CTCACTCTGTTGCCCAGGCCAGG - Intronic
1139804220 16:69550368-69550390 GCCTCTCTGTTGCCTAGGCTGGG + Intergenic
1139897621 16:70300234-70300256 CACACTCTGTTGCCCAGGCTAGG + Intronic
1140465050 16:75174828-75174850 GACACTATGGTGCCTGGGGTTGG - Intergenic
1141483770 16:84325231-84325253 CTCACTCTGTTGCCTAGGCTGGG + Intronic
1141528322 16:84627876-84627898 CACGCACTGTTGCCTGGGGCTGG - Intergenic
1142127453 16:88417222-88417244 GCCACTGTGTGGCCTGGGGCAGG + Intergenic
1142539993 17:651391-651413 CTCACTCTGTGGCCCAGGGCTGG - Intronic
1142779853 17:2173118-2173140 GAGACTCAGTTGCCTAATGCAGG + Intronic
1143076330 17:4347121-4347143 GTAACTCTGTTGCCCAGGGCTGG - Intronic
1143762843 17:9117297-9117319 GACACTCTGCTTCCCAGGGAAGG + Intronic
1144401780 17:14911120-14911142 GACTCTTTGTTGCCTGGGGCTGG - Intergenic
1144710092 17:17395841-17395863 CTCACTCTGTTGCTTAGGCCGGG - Intergenic
1146407399 17:32550943-32550965 GACACTCTGTTGCCTAGGGCTGG - Intronic
1146857590 17:36266586-36266608 CTCACTCTGTTGCCTAGGCCAGG + Intronic
1146988637 17:37246542-37246564 GCCACTCTGGTGTCTAAGGCGGG - Intronic
1147076383 17:37991120-37991142 CTCACTCTGTTGCCTAGGCCAGG + Intronic
1147077420 17:38001939-38001961 CTCACTCTGTTGCCTAGGCCAGG - Intronic
1147087908 17:38070665-38070687 CTCACTCTGTTGCCTAGGCCAGG + Intergenic
1147109302 17:38249848-38249870 CTCACTCTGTTGCCTAGGCCAGG - Intergenic
1147470323 17:40652591-40652613 CTCACTCTGTTGCCTAAAGCTGG + Intergenic
1147746288 17:42696774-42696796 CTCACTCTGTCGCCTAGGCCTGG - Intronic
1147765925 17:42836034-42836056 CTCACTCTGTTGCCTAGGCTGGG + Intronic
1148282525 17:46360046-46360068 CTCACTCTGTTGCCCTGGGCTGG - Intronic
1148304743 17:46577971-46577993 CTCACTCTGTTGCCCTGGGCTGG - Intronic
1148420148 17:47538236-47538258 CTCACTCTGTTGCCTAGGCCAGG + Intronic
1148655486 17:49280174-49280196 CTCACTCTGTTGCCCAAGGCTGG + Intergenic
1149199283 17:54164003-54164025 AACACTATGTTGAATAGGGCTGG - Intergenic
1149284384 17:55146385-55146407 GTCACTCTGTTAGCTAGGGCTGG + Intronic
1150233110 17:63569741-63569763 GTCACTCTGTTGCTCAGGGTGGG + Intronic
1150409368 17:64930526-64930548 GACATTCCATTGCCCAGGGCCGG - Intergenic
1152381892 17:79946505-79946527 CACACTCCGTGGCCTGGGGCTGG + Intronic
1152744715 17:82033406-82033428 GACGCTCTGATCCCTAGGCCCGG - Intronic
1153051352 18:905704-905726 GACCCTGAGCTGCCTAGGGCTGG - Intronic
1153931239 18:9881504-9881526 CTCACTCTGTTGCCCTGGGCTGG - Intergenic
1155475082 18:26229531-26229553 GTCACTCTGTTGCCCAGGCTGGG + Intronic
1156021619 18:32606186-32606208 CAAGCTATGTTGCCTAGGGCTGG + Intergenic
1157222686 18:45838825-45838847 GCCAAGCTGTTGCCCAGGGCCGG - Exonic
1157704870 18:49797300-49797322 CTCACTCTGTTGCCCATGGCTGG + Intronic
1157826057 18:50813486-50813508 GAAACTCTGGGGCCTAGGCCTGG - Intronic
1159952257 18:74493309-74493331 GAGTCTCTGTTGCCCAGGGCTGG - Intergenic
1161955846 19:7494558-7494580 GTATCTCTGTTGCCTAGAGCGGG - Intronic
1161989353 19:7675720-7675742 TTCACTCTGTTGCCCAGGCCGGG - Intergenic
1163029608 19:14535724-14535746 CTCACTCTGTTGCCCAGGACCGG - Intronic
1163384711 19:16992480-16992502 CTCACTCTGTTGCCTAGGCTGGG + Intronic
1163597785 19:18230470-18230492 CTCACTCTGTTGCCCAGGCCGGG - Intronic
1163983039 19:20919776-20919798 GATACTCAGGTGTCTAGGGCAGG - Intergenic
1164981097 19:32615182-32615204 GAGACTCATTAGCCTAGGGCGGG - Intronic
1165764251 19:38340804-38340826 CTCACTATGTTGCCTAAGGCTGG + Intronic
1165848614 19:38835717-38835739 GACACCCTGTTGCCCAGGCTGGG + Intronic
1166072860 19:40397063-40397085 GACACTCCGATGCCAAGGGAGGG + Exonic
1167658192 19:50780092-50780114 GACAGTCTGTCTCCTACGGCTGG - Intergenic
925036989 2:695202-695224 AACTTTCTGTTGCCAAGGGCAGG + Intergenic
926111600 2:10187526-10187548 GACGCTCTGAGGCCTGGGGCTGG + Intronic
926868052 2:17381280-17381302 GACACAGTGTTACCTAAGGCTGG + Intergenic
929410767 2:41695802-41695824 GACATTCTGTTCCCTTGGCCTGG + Intergenic
930979004 2:57498756-57498778 GAGACTCTGTTTCCTAGAACTGG + Intergenic
931335428 2:61337481-61337503 CTCACTCTGTTGCTCAGGGCTGG + Intronic
931385299 2:61793010-61793032 CTCACTCTGTTGCCTAGGCTGGG - Intergenic
932143848 2:69302036-69302058 GACACTGTAGTACCTAGGGCAGG + Intergenic
932691277 2:73915854-73915876 GATTCACTGTTACCTAGGGCTGG + Intronic
932696500 2:73961218-73961240 GACTGGTTGTTGCCTAGGGCTGG - Intergenic
933142825 2:78815198-78815220 CTCACTATGTTCCCTAGGGCTGG - Intergenic
933692744 2:85192048-85192070 GACTCTGTGCTGCATAGGGCTGG + Intronic
935319719 2:101874166-101874188 GTCACTCTGTGGCCTAGTGTTGG - Exonic
936448492 2:112615736-112615758 CTCACTCTGTTGCCCAAGGCTGG + Intergenic
936797351 2:116223813-116223835 CACACTGTGTTGCCTGGGGCTGG - Intergenic
937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG + Intronic
937629432 2:124083320-124083342 CTTACTCTGTTGCCCAGGGCTGG - Intronic
937768803 2:125694896-125694918 GGGAGTCTGCTGCCTAGGGCAGG - Intergenic
938529989 2:132175496-132175518 GACATTCAGTTCCCTGGGGCAGG + Intronic
938764050 2:134448768-134448790 GACCCTCTGGTGCCTGGGGTGGG - Exonic
940550190 2:155144298-155144320 GACTCCCTCTTCCCTAGGGCAGG - Intergenic
941523239 2:166575010-166575032 CTCACTCTGTTGCCCAGGCCTGG - Intergenic
942411721 2:175716765-175716787 TTCGCTCTGTTGCCTAAGGCTGG + Intergenic
943770901 2:191715536-191715558 GAAACTCTTTTGCCTATAGCTGG - Intergenic
945459126 2:210083797-210083819 CTCACTCTGTCGCCCAGGGCTGG - Intronic
946018142 2:216620579-216620601 GTCACTCTGTTGCCCAGGCTGGG - Intergenic
946154192 2:217796425-217796447 GAATCTCTGCTGCCTGGGGCTGG - Intergenic
947190238 2:227497041-227497063 GCTATTCTGTTGCCTATGGCAGG + Intronic
948063070 2:235056208-235056230 GACACACTGGTCCCCAGGGCTGG - Intergenic
948352204 2:237350231-237350253 GAGACCCTGTGGCCTGGGGCTGG + Intronic
948624719 2:239261885-239261907 GACTCTCAGTTGCCCTGGGCAGG - Intronic
948893660 2:240918610-240918632 GGCACTCTGCTGCCTTGGGGTGG + Intergenic
1168810032 20:699248-699270 GACACTCCGTTCCCTAAGCCAGG - Intergenic
1168901800 20:1371135-1371157 GACCCTCTGGTTCCTATGGCAGG + Intronic
1169138476 20:3212348-3212370 CTCACTCTGTCGCCTAAGGCTGG + Intronic
1170360173 20:15537502-15537524 GTCACTCTGTTGCCCAGGCTGGG + Intronic
1170842980 20:19939071-19939093 CTCGCTCTGTTGCCTAGAGCTGG + Intronic
1172521226 20:35567259-35567281 CTCACTCTGTTGCCCAGGGTGGG - Intergenic
1172551789 20:35806189-35806211 CTCACTCTGTTGCCTAGGCTGGG + Intronic
1173645975 20:44633377-44633399 GACTCTCTGTTTCCTAGGTCTGG + Intronic
1174030385 20:47619823-47619845 CACACTCTGTTACCCAGGCCTGG + Intronic
1174262672 20:49308074-49308096 CTCACTTTGTTGCCTAGGGCTGG + Intergenic
1175150823 20:56932533-56932555 CTCACTGTGTTGCCTAGGGCTGG - Intergenic
1175976645 20:62713733-62713755 GACACTCAGCTGCCTGTGGCAGG - Intronic
1176780797 21:13192584-13192606 CTCACTCTGTCGCCCAGGGCTGG + Intergenic
1178210299 21:30523523-30523545 GACTCACTGTTCCCCAGGGCTGG + Intergenic
1178431928 21:32525159-32525181 GTCACTCTGTTGCCTAGGCTGGG - Intergenic
1179332221 21:40414775-40414797 AACACTTTGTTGCCTTAGGCAGG - Intronic
1182974626 22:34611380-34611402 GTCACTTTGTTGCCCAGAGCTGG - Intergenic
1183195018 22:36347535-36347557 CTCATTATGTTGCCTAGGGCTGG - Intronic
1183239638 22:36647708-36647730 CACACCCTGTTGCCTCTGGCTGG + Intronic
1183677595 22:39308294-39308316 CTCACTGTGTCGCCTAGGGCTGG - Intergenic
1183924497 22:41196490-41196512 CTCACTCTGTCGCCCAGGGCCGG - Intergenic
1184796038 22:46733176-46733198 CCCACTCTGTCGCCCAGGGCTGG - Intronic
952431327 3:33226482-33226504 GTCACTCTGTTGCCCAGGCTGGG + Intergenic
953046300 3:39296573-39296595 CAGCCTCTGTTGCCTAGGGAAGG - Intergenic
953574462 3:44101852-44101874 GACTGTCTGCTTCCTAGGGCAGG + Intergenic
954267647 3:49482404-49482426 GACATTCAGTTCCCAAGGGCAGG - Intronic
954512232 3:51135748-51135770 CTCACTCTGTTGCCTAGGCTGGG + Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955037260 3:55281207-55281229 CACACTCTGTTCACTAGGGTAGG + Intergenic
955286220 3:57644333-57644355 CTCACTCTGTTCCCCAGGGCTGG + Intronic
955729779 3:61972681-61972703 CTCACTCTGTTGCCCAGGGTGGG + Intronic
955901803 3:63764013-63764035 CTCACTCTGTTGCCTAGGCTGGG - Intergenic
957523434 3:81350216-81350238 GACACTCCAATGCCTTGGGCTGG - Intergenic
958943232 3:100336763-100336785 GACATTCCGTTGCCCAGGGACGG + Intronic
960431131 3:117570230-117570252 CTCACTCTGTTGCCTAGGCTGGG - Intergenic
960745774 3:120886811-120886833 CTCACTCTGTTGCCCAGAGCTGG + Intergenic
961014752 3:123458978-123459000 CTCACTCTGTTGCCCAAGGCTGG - Intergenic
962556487 3:136557571-136557593 CACACTCTGTTGCCCAGGCTGGG + Intronic
962928090 3:140013295-140013317 GAAGCTCTGGAGCCTAGGGCTGG + Intronic
964617167 3:158678971-158678993 CTCACTATGTTGCCCAGGGCTGG - Intronic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
966722357 3:183076905-183076927 GATTCACAGTTGCCTAGGGCTGG - Intronic
968094125 3:195916049-195916071 CTCTCTCTGTTGCCCAGGGCTGG - Intergenic
970399318 4:15702713-15702735 CTCACTCTGTCGCCCAGGGCTGG + Intronic
972364834 4:38364735-38364757 GACATTCTGGTACCTAAGGCTGG - Intergenic
972453742 4:39231282-39231304 CTCACTCTGTTGCCCAGGGTGGG - Intronic
972584680 4:40426568-40426590 CTCACTATGTTGCCCAGGGCTGG + Intronic
972620822 4:40746795-40746817 GAAACTCTGGGGACTAGGGCAGG - Intergenic
973610438 4:52631575-52631597 GACACACTGTTCTCTAGGTCTGG + Intronic
975404545 4:73975155-73975177 CTCACTGTGTTGCCCAGGGCTGG - Intergenic
976117505 4:81743834-81743856 GAGACTCTGTTGCCAAGAACTGG - Intronic
976388442 4:84484843-84484865 GACACTCTGCTGTCTAGGAGAGG - Intergenic
977046379 4:92072897-92072919 GACACACTGTTGCAAAGGGTTGG - Intergenic
977596134 4:98883239-98883261 CACACTCTGTTGCCCAGGCTGGG - Intronic
978150668 4:105430608-105430630 GACACTCTGTTGCCTAGATCAGG - Intronic
978422507 4:108547518-108547540 GTCATTCTGTTGCCCAGGCCAGG - Intergenic
980962861 4:139493567-139493589 CTCACTCTGTTGCCTAAGGCTGG + Intergenic
982234193 4:153236887-153236909 CTCACTATGTTGCCTAGGCCTGG + Intronic
986342307 5:6801295-6801317 TACACTCTGTACCCTATGGCAGG + Intergenic
987315028 5:16716023-16716045 GTCACTCTGTTGCCCAGGCTGGG - Intronic
988023350 5:25652218-25652240 AACACTCTGTTGAATAGGGGTGG + Intergenic
988909985 5:35829817-35829839 CTCACTCTGTTGCCCAGGCCCGG - Intergenic
989632180 5:43496617-43496639 TTTACTCTGTTGCCCAGGGCTGG + Intronic
990881205 5:60541243-60541265 TACCCTCTGTGGACTAGGGCTGG - Intergenic
993409455 5:87555612-87555634 GACTCACTGTTCCATAGGGCTGG + Intergenic
995235826 5:109829132-109829154 GACCCTCTGTTCCTTAGGGATGG - Intronic
997626382 5:135333991-135334013 GACAGTCTGTGACTTAGGGCTGG - Exonic
999792887 5:154959060-154959082 GTCACTCCATTGCCCAGGGCTGG + Intronic
999883436 5:155892522-155892544 GACATTCTTTTACATAGGGCAGG - Intronic
1000181163 5:158812702-158812724 GACATTGTGTTGTCAAGGGCAGG - Intronic
1001139798 5:169135134-169135156 CTCACTCTGTTGCCCAGGGTGGG + Intronic
1002132036 5:177087525-177087547 GACTGTCTGATGCCTAAGGCAGG + Intronic
1002297136 5:178238001-178238023 GACACTCTGCTCCCTGGAGCTGG + Exonic
1002364706 5:178700815-178700837 GAATCTCTGGGGCCTAGGGCAGG + Intergenic
1003008579 6:2405016-2405038 CTCACTCTGTTGCCCAGGCCGGG + Intergenic
1003132653 6:3408700-3408722 AACACTCTCTTGCCTGGGGGTGG + Intronic
1003954392 6:11148333-11148355 CTCACTCTGTTGCCCAGTGCTGG + Intergenic
1004030971 6:11869354-11869376 CTCACTCTGTTGCCCAGGCCTGG + Intergenic
1004681417 6:17899021-17899043 GACACTATGTTGCCCCAGGCTGG + Intronic
1006987985 6:38189518-38189540 CTCACTCTGCTGCCCAGGGCTGG + Intronic
1007771486 6:44195970-44195992 CTCACTCTGTTGCCCAGGCCGGG + Intergenic
1011414427 6:87102743-87102765 CTCACTCTGTTGCCCAGAGCTGG + Intergenic
1011684034 6:89809958-89809980 CTCACTCTGTTGCCTAGGCTGGG - Intronic
1012025115 6:93979833-93979855 GAATCTCTGTTGCCCAGAGCAGG - Intergenic
1012169740 6:96002801-96002823 GACACTTTGCAGCCTGGGGCCGG + Intergenic
1013224658 6:108111956-108111978 GTCACTCTGTTGCCCAGGCTGGG - Intronic
1013234376 6:108184160-108184182 CTCACTCTGTTACCTGGGGCTGG - Intronic
1013377183 6:109528954-109528976 CTCACTCTGTTGCCCAGGGCAGG - Intronic
1015100838 6:129477982-129478004 CTCACTCTGTTGCCTCAGGCTGG + Intronic
1015157798 6:130116554-130116576 GTCACTATGTTGCTCAGGGCTGG - Intronic
1016339167 6:143042856-143042878 CTCACTCTGTTGCCCCGGGCTGG + Intergenic
1016452302 6:144195582-144195604 CTCACTCTGTTGCCCAGGCCAGG - Intergenic
1017095279 6:150799414-150799436 CACACTCTGTTCCCCAGGGAGGG + Intronic
1018539564 6:164863837-164863859 CACATTCTGTTGCCAAGTGCAGG + Intergenic
1018916841 6:168138231-168138253 GTCACTCTGTTGCCAAGGGTGGG + Intergenic
1019743217 7:2685527-2685549 CTCACTCTGTTGCCCAGAGCTGG - Intronic
1019792582 7:3026532-3026554 CTCACTCTGTTGCCCAGGTCAGG + Intronic
1021491898 7:21228190-21228212 CTCACTCTGTTGCCCAGGGTAGG - Intergenic
1021891038 7:25186579-25186601 GACAGTCTTTTGCCTAGATCGGG - Intergenic
1022904790 7:34845295-34845317 GACACACTGTTCCCCAGGGCTGG + Intronic
1023550148 7:41361236-41361258 GGCACACTGTTATCTAGGGCAGG + Intergenic
1023821197 7:43981477-43981499 CTCACTCTGTTGCCCAGGGTGGG - Intergenic
1024123240 7:46266576-46266598 CACACTCTGTTGCCCAGGCTGGG + Intergenic
1026930579 7:74220970-74220992 GACACTCTGTGTCCCAGAGCAGG - Intronic
1027142668 7:75670176-75670198 CTCACTCTGTTGCCTAGGCTGGG + Intronic
1028190909 7:87850736-87850758 CTCACTCTGTTGCCCAGGCCTGG - Intronic
1029933357 7:104396938-104396960 CTCACTCTGTTGCCCAAGGCTGG - Intronic
1030719720 7:112856278-112856300 GTCACTCTGTTGCCCAGGCTGGG + Intronic
1032459901 7:132102696-132102718 GACACTCAGATTCCTGGGGCTGG - Intergenic
1032823845 7:135550385-135550407 CACACACTGCTGCCCAGGGCCGG + Intergenic
1033383980 7:140853339-140853361 TTCACTCTGTTGCCTAGGTTGGG - Intronic
1037348684 8:17925804-17925826 CACACTCTGTTGCCTAGGCTGGG - Intronic
1037442109 8:18927242-18927264 GTCACTCTGTTGCCCAGGCTGGG + Intronic
1037488804 8:19376590-19376612 AGCACTCTGTTGCCCAGGCCTGG - Intronic
1038461626 8:27722057-27722079 CTCACTCTGTTGCCTAGGCTGGG - Intergenic
1041710663 8:60891347-60891369 CACACTCTGACTCCTAGGGCAGG + Intergenic
1042555323 8:70029514-70029536 CTCACTCTGTTGCCTAGTGAGGG + Intergenic
1042885051 8:73539811-73539833 TTCACTCTGTCGCCCAGGGCTGG - Intronic
1043587038 8:81781534-81781556 GAGGATCTGTTTCCTAGGGCAGG + Intergenic
1044078940 8:87860071-87860093 GAGACTCTATTGCCTAAGGATGG + Intergenic
1044405092 8:91817750-91817772 GCCACTCTGGAGGCTAGGGCAGG - Intergenic
1044641997 8:94392625-94392647 CTCACTCTGTCGCCCAGGGCTGG + Intronic
1045035524 8:98173632-98173654 GACACTCTGAGGCGTAAGGCTGG - Intergenic
1045100654 8:98840539-98840561 GTCACTCTGTTGCCCCAGGCTGG - Intronic
1045562656 8:103280685-103280707 CTCTCTCTGTTGCCTAGGGCTGG - Intergenic
1046765621 8:118066388-118066410 CTCACTCTGTTGCCCAGAGCTGG + Intronic
1047087732 8:121537551-121537573 GACACTTTGTTGCATAGGATGGG - Intergenic
1047733149 8:127743145-127743167 GCCCCTTTGTGGCCTAGGGCTGG + Intergenic
1048959243 8:139562192-139562214 GTCACGATGTTGCCTTGGGCTGG - Intergenic
1049068410 8:140337862-140337884 GGCACCCTGTTGCCTGGTGCAGG + Intronic
1049232574 8:141492203-141492225 GGCACTCTGTTACCTAGGTCAGG - Intergenic
1050293907 9:4185118-4185140 GACAAGTTGTTGCCTAGGGTTGG - Intronic
1050454439 9:5819844-5819866 GACAGGCAGTTGCCTAGGGATGG + Intronic
1053254684 9:36605920-36605942 CTCACTCTGTTGCCTAGGCTGGG - Intronic
1053364511 9:37512994-37513016 GACACTCTGTTGCCCAGGCTGGG + Intronic
1054924964 9:70579882-70579904 GACACTCAGTTGCCTCATGCTGG + Intronic
1055031288 9:71773275-71773297 GTCACTATGTTGCCCAGGGTGGG + Intronic
1056050055 9:82758837-82758859 CTCACTCTGTTGCCTAGGGTGGG + Intergenic
1056871473 9:90285326-90285348 CTCACTCTGTTGCCCAGGGTTGG + Intergenic
1057613969 9:96571746-96571768 GAGACTCTGTTTCCCAAGGCCGG - Intronic
1059310444 9:113385355-113385377 GACTCTCTGTTGCCCAGGATGGG + Intergenic
1060079290 9:120626717-120626739 CAAACTCTGTTTCCTCGGGCTGG - Intronic
1060190833 9:121591437-121591459 CTCACTCTGTTGCCCAAGGCTGG - Intronic
1061313929 9:129782304-129782326 CTCACTCTGTTGCCCAGGGTGGG + Intergenic
1062011257 9:134268056-134268078 GACAATCGGTTGCCAAGGTCAGG - Intergenic
1186743888 X:12546208-12546230 CTCACTCTGTTGCCCAGGGGTGG + Intronic
1186749414 X:12606329-12606351 GCCACTCTCTTGCCTAGAGAAGG - Intronic
1187950936 X:24469578-24469600 CTCACTATGTTGCCCAGGGCTGG - Intronic
1188984719 X:36758905-36758927 GAAACTGTCTAGCCTAGGGCAGG - Intergenic
1189440855 X:41034710-41034732 CTCACTCTGTTGCCTAAGGCTGG - Intergenic
1189659333 X:43279753-43279775 GACACGCTGCAGCCTCGGGCCGG + Intergenic
1189927549 X:45972535-45972557 TACACTATTTTTCCTAGGGCTGG + Intergenic
1192447106 X:71219362-71219384 CTCACTATGTTGCCTATGGCTGG + Intronic
1192498387 X:71631910-71631932 CTCACTCTGTTGCCTAGGCTGGG - Intergenic
1195726578 X:107923826-107923848 GACTATCTGTGGCCTTGGGCAGG + Intronic
1196206912 X:112950507-112950529 GACACTCTAGTGCTTAAGGCAGG + Intergenic
1196243349 X:113369430-113369452 GAGTCTCTGTCGCCCAGGGCTGG + Intergenic
1197040049 X:121925934-121925956 CTCACTCTGTTGCCCAGAGCTGG - Intergenic
1197612954 X:128659246-128659268 CTCACTCTGTTGCCTAGGCTGGG + Intergenic
1197714850 X:129699281-129699303 CTCTCTCTGTTGCCCAGGGCTGG + Intergenic
1197741290 X:129896356-129896378 CTCACTCTGTTGCCCAGGGCTGG + Intergenic
1197891674 X:131275679-131275701 TACTCTCTGGTGCCGAGGGCCGG - Exonic
1198401416 X:136272172-136272194 GTCACTCTGTTGCCCAGGCTGGG + Intergenic
1199010656 X:142754337-142754359 CACACTCTGCTGCCTGGGGTTGG + Intergenic