ID: 1146409140

View in Genome Browser
Species Human (GRCh38)
Location 17:32566984-32567006
Sequence CTGTGAACATGGATGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146409140_1146409145 -3 Left 1146409140 17:32566984-32567006 CCGTGCTCCATCCATGTTCACAG 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1146409145 17:32567004-32567026 CAGAATGGAGGAAATCAAAAAGG 0: 1
1: 1
2: 5
3: 49
4: 575
1146409140_1146409149 26 Left 1146409140 17:32566984-32567006 CCGTGCTCCATCCATGTTCACAG 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1146409149 17:32567033-32567055 TGATGCGGCTGCAGGCTTCTGGG 0: 1
1: 0
2: 2
3: 9
4: 132
1146409140_1146409146 11 Left 1146409140 17:32566984-32567006 CCGTGCTCCATCCATGTTCACAG 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1146409146 17:32567018-32567040 TCAAAAAGGAGCAGATGATGCGG 0: 1
1: 0
2: 2
3: 36
4: 337
1146409140_1146409147 18 Left 1146409140 17:32566984-32567006 CCGTGCTCCATCCATGTTCACAG 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1146409147 17:32567025-32567047 GGAGCAGATGATGCGGCTGCAGG 0: 1
1: 0
2: 2
3: 33
4: 321
1146409140_1146409148 25 Left 1146409140 17:32566984-32567006 CCGTGCTCCATCCATGTTCACAG 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1146409148 17:32567032-32567054 ATGATGCGGCTGCAGGCTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146409140 Original CRISPR CTGTGAACATGGATGGAGCA CGG (reversed) Intronic
900271652 1:1793162-1793184 CTGTGAACATGGAGGAAATAAGG - Intronic
900644715 1:3703718-3703740 CTGTTCTCAGGGATGGAGCAGGG + Intronic
900777619 1:4596456-4596478 CTGAGAACAGGGCTGGAGCCCGG + Intergenic
901618895 1:10565380-10565402 CTAGGAACATGGATTGACCAGGG - Intronic
902598416 1:17524820-17524842 CAGTGAACAGGTTTGGAGCATGG + Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903207205 1:21791515-21791537 CTGTGTACTTGGACAGAGCAGGG + Intergenic
903340690 1:22652566-22652588 CTGAGAACAGGGAAAGAGCAGGG + Intergenic
905802599 1:40854778-40854800 GTGTGGCCAGGGATGGAGCAGGG + Intergenic
906657509 1:47559348-47559370 CTGTGAACATGGACTGGCCATGG - Intergenic
906735975 1:48128574-48128596 CTGAGAAATTGGAGGGAGCAAGG + Intergenic
907029233 1:51154063-51154085 CTGGGACCATGGTTGGAGCTGGG - Intergenic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907853703 1:58280972-58280994 CTTTGTACATGGATGGAGGTTGG + Intronic
908819864 1:68074337-68074359 GTGGCAACATGGATGGAGCTGGG - Intergenic
910575670 1:88760511-88760533 TTGTGTACATGCATGGAGCAGGG + Intronic
911357325 1:96838380-96838402 TTGTGAACATGGCTGGATGAGGG + Intergenic
912453890 1:109785065-109785087 CTTGGAACATGGAAGAAGCATGG + Intergenic
915346760 1:155201451-155201473 CAGTGAGCATGGATGTGGCAGGG + Exonic
915597046 1:156901848-156901870 CTGGGAAGATGGCTGGAGCAGGG + Intronic
916495331 1:165341294-165341316 ATGTGCAAATGGATGGAGCCCGG - Intronic
916794214 1:168150777-168150799 GTGTGAACAAGGAATGAGCAAGG - Intergenic
918109927 1:181446565-181446587 CTGTAAACATGAATTCAGCATGG - Intronic
918149722 1:181787837-181787859 CTGTCATGATGGTTGGAGCATGG + Intronic
920038310 1:203080060-203080082 CCCCAAACATGGATGGAGCAAGG + Intergenic
921709773 1:218362271-218362293 CTATAAACATGGAAGGTGCATGG + Intronic
922785093 1:228278666-228278688 CTGTGAACGTGGTGGGGGCATGG - Intronic
923234180 1:232016227-232016249 AAGTGAACATGGATGGAGTTTGG + Intronic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
924642429 1:245847018-245847040 CTTTGAACAGGGAGAGAGCAGGG - Intronic
924823795 1:247519107-247519129 ATGTGAATGTGAATGGAGCAAGG + Intronic
1063611765 10:7568819-7568841 CCGTGAACATGTATGGACAAAGG - Intronic
1066501580 10:36000304-36000326 CAGTCAACAAGGATGGAGAAAGG - Intergenic
1067510289 10:46889121-46889143 CTGTGAAAATGAATGTTGCAGGG - Intergenic
1067651966 10:48162736-48162758 CTGTGAAAATGAATGTTGCAGGG + Intronic
1068484246 10:57636242-57636264 CTGTGTTCATGAATGGATCAAGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1069682550 10:70295631-70295653 CTATGAAGATGGAGGGAGCGGGG + Intergenic
1069774041 10:70916588-70916610 ATGGGAACATGGAGGGAGCAAGG + Intergenic
1071810255 10:89172115-89172137 CTGAGAACATGGAAGGATCATGG - Intergenic
1072630407 10:97141452-97141474 CTCTGAACATGCTTGGAGGAGGG - Intronic
1072997343 10:100257113-100257135 AAGTGAAAATTGATGGAGCAAGG - Intronic
1073847446 10:107573895-107573917 CCATGGACATGGATGGAGGAGGG + Intergenic
1076862938 10:133150452-133150474 GTGGGAAAATGGATGGAGCTGGG + Intergenic
1076980840 11:203912-203934 TGGTGAGCATGGATGGAGAAAGG + Exonic
1077053779 11:580090-580112 CTCTGATCATGGATGGAGGTTGG + Intronic
1077353509 11:2104013-2104035 CTGCGACCATGGCTGGAGCTGGG - Intergenic
1077498624 11:2898685-2898707 GTGTGGACTTGGATGGGGCATGG - Intronic
1078848722 11:15144588-15144610 CTGTCAACATGGAAGGGACAGGG - Intronic
1079127606 11:17730176-17730198 CTGTGAACATGCTTGCAGGAGGG + Intergenic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1081046651 11:38281796-38281818 GTGGGAACATGAATGGAGCTGGG + Intergenic
1081248569 11:40800427-40800449 TTGTGAACATGTATGGAGACTGG + Intronic
1081963372 11:47154524-47154546 CTGTGAACATGGATGCAAGGAGG + Intronic
1082000633 11:47392035-47392057 CTGTGACCAGGGCAGGAGCAGGG - Intergenic
1082114191 11:48309941-48309963 CTGAGAACTTGGATGGAGGTGGG - Intergenic
1082789100 11:57335286-57335308 CTGTGCTCACGGATGGAGCCAGG + Intronic
1083802136 11:65052984-65053006 CCGTGTGCCTGGATGGAGCAAGG - Intronic
1083903414 11:65654830-65654852 CTGATACCATGGCTGGAGCAGGG + Exonic
1084096613 11:66915587-66915609 CTGTGATCCTGCAGGGAGCAAGG + Intronic
1084575921 11:69987883-69987905 CTGTAATCATGGATGGATGACGG + Intergenic
1085046771 11:73358092-73358114 CTGTGAGCAAGAATGGGGCAGGG + Intronic
1085449073 11:76621258-76621280 CTATGAACATGGAAGGGGCTGGG + Intergenic
1088158742 11:106842216-106842238 CTGTCAATCTTGATGGAGCAAGG - Intronic
1089184860 11:116607924-116607946 CTGCGAGCCTGGATGGGGCAGGG - Intergenic
1089778591 11:120856989-120857011 CTGGGAACATGGAGGGATAAGGG - Intronic
1089831083 11:121328875-121328897 GGGTGAAAATGGAGGGAGCAGGG - Intergenic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1091004399 11:131939547-131939569 CTGTGCAGATGGAGGGAGTATGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1094275333 12:28668826-28668848 CAGTGAGCAAGGATGGATCAGGG - Intergenic
1094844632 12:34356047-34356069 CTGTGAACCTGGGAGGTGCAGGG + Intergenic
1096009247 12:48198866-48198888 TTGTCAACATGGATGGCGGAAGG - Intergenic
1096372454 12:51080406-51080428 TTGTGAACTTGGATGCAGCAAGG + Intronic
1101318689 12:103653513-103653535 GTGTGAAGATGGATGATGCATGG + Intronic
1101504992 12:105337856-105337878 CTTTGAACAAGGATGGGGTATGG + Intronic
1102633745 12:114304446-114304468 CTGTGAAGATGCATGGAGTTGGG - Intergenic
1103587441 12:121966561-121966583 CTTTGGTCATGGATGGGGCATGG - Intronic
1104017131 12:124968822-124968844 CTGTGAGCTTGGATGGCACAAGG - Intronic
1104981186 12:132573747-132573769 CTGTGAGCCTGGATGGGCCAAGG - Intronic
1105293648 13:19070682-19070704 CTTTGAACATGGAAGGGGCCAGG - Intergenic
1106125791 13:26899042-26899064 CTGAGACTAAGGATGGAGCATGG + Intergenic
1108098857 13:46934200-46934222 CTGTCCACATGGATGCTGCAAGG - Intergenic
1108103713 13:46985939-46985961 CAGTGAAGCTGGATGGAGCCTGG + Intergenic
1113392419 13:109910207-109910229 CGGTGCCCATGGAGGGAGCAGGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116129055 14:40829729-40829751 GTAGGAACATGGATGGAGCCAGG + Intergenic
1118917018 14:70116141-70116163 CTTTGAACTTGGATGTAGCCTGG + Intronic
1120775491 14:88431752-88431774 GTGGCAACATGGATGGAACATGG - Intronic
1122637926 14:103138879-103138901 CTGTGAGCAGGGGTGGAGCGGGG + Intergenic
1127737171 15:61853088-61853110 CTCTGATCAAGGATGGAGAAAGG + Exonic
1127796186 15:62440428-62440450 CTGTGAACTTGGCAAGAGCACGG + Intronic
1127822713 15:62674173-62674195 CTGTTAACATGCATTGAGGAAGG + Intronic
1127931171 15:63598489-63598511 CTGGGACCATGGAGGGAGCCTGG - Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1130195527 15:81777159-81777181 CTGGGAACATGGCTGGGGCATGG - Intergenic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1132804155 16:1768046-1768068 CTGGGGACATGGGAGGAGCATGG - Intronic
1133795732 16:9044740-9044762 CTGTGGACATGGCTGGATCCAGG + Intergenic
1137232031 16:46575190-46575212 CTGTGGAAGTGTATGGAGCAAGG + Intergenic
1137474123 16:48792005-48792027 CTTTGAAGATGGAGGGAGCTAGG - Intergenic
1137548629 16:49421485-49421507 CTGTGAACGTGGGTGGGGAAGGG + Intergenic
1137955666 16:52826401-52826423 CTTTGAAAATGGATGTAGGAAGG - Intergenic
1139406980 16:66726951-66726973 CTGTCACCCTGGCTGGAGCATGG + Intronic
1143009981 17:3860916-3860938 CTGGAAACATGGATGGACAAGGG - Intronic
1143370009 17:6433748-6433770 ATGTGAAGATGGAGGGAACAAGG - Intronic
1143462624 17:7114008-7114030 CTGTGAACAGGGACTGAGGAGGG - Intronic
1143557695 17:7672485-7672507 CTGGGAGGATGGATGGAGCCTGG + Intronic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1146279981 17:31538548-31538570 CGGCGGACATGGAGGGAGCATGG - Intergenic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1146769229 17:35553335-35553357 CTGAGAACAAGGATGTATCAGGG + Exonic
1146987733 17:37237189-37237211 CAGTGAAAATGGATGCACCAAGG - Intronic
1147217137 17:38907406-38907428 CTGAGAACAGGTGTGGAGCAGGG - Intronic
1149046299 17:52249680-52249702 CTGTAGACAGGCATGGAGCAGGG + Intergenic
1150289998 17:63975609-63975631 TTGTGAAAATGGAGGTAGCATGG - Intergenic
1152330749 17:79671196-79671218 CTCTGAGCCTGGATGGAGGAGGG - Intergenic
1153203098 18:2666587-2666609 GTGTCAACATGAATGGAGAATGG - Intronic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG + Intronic
1161912531 19:7205299-7205321 CTGTGAACTTGATTGGAGCATGG - Intronic
1163214501 19:15865874-15865896 GTAGGAACATGGATGGAGCTGGG + Intergenic
1164436704 19:28236639-28236661 CTGTGAACCAGAATGGAGAAAGG + Intergenic
1165863368 19:38921288-38921310 CTGGGAACATGTCTGGAGCCTGG - Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1167758072 19:51425912-51425934 CTCTGCAGATGGCTGGAGCAAGG - Intergenic
1168389163 19:55992163-55992185 GTGGGAACATGGATGGAACTGGG - Intergenic
925495109 2:4439033-4439055 TTGTGACCATGGCTGGAGAAAGG - Intergenic
925821503 2:7803663-7803685 CTGGGAACATGTGTGGACCAAGG + Intergenic
926782991 2:16492611-16492633 GTGGGAACATGCATGGAGCTGGG + Intergenic
928285191 2:29984141-29984163 GCAGGAACATGGATGGAGCAGGG - Intergenic
929241718 2:39660366-39660388 GTGTTTACATGGATGGAGTAGGG + Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
933286097 2:80386146-80386168 CTTTGAAAATGGATGCAGCCTGG + Intronic
933301280 2:80544194-80544216 CTCTGAAGATGGATGGGGCCAGG - Intronic
933557009 2:83843376-83843398 TTGTCAACCTGGCTGGAGCAGGG + Intergenic
933846796 2:86333287-86333309 ATGTGCAAATGGATGGAGCTGGG - Intronic
935607841 2:104988404-104988426 CTGTGGACAAGGATGGCACATGG + Intergenic
936954388 2:118009959-118009981 CTGTCACCCTGGCTGGAGCACGG + Intronic
937034165 2:118766829-118766851 CTGTGCACCTGGGTGGGGCATGG - Intergenic
937458724 2:122067093-122067115 TTGGGAAGATGGATGGTGCAGGG + Intergenic
939532867 2:143386851-143386873 GTGGGAACATGGATGGAGCTGGG + Intronic
942061020 2:172228806-172228828 CTGTGAACAGGAATGAAGAAAGG + Intergenic
944163052 2:196686906-196686928 TCGTGATCATGGATGGAGCTGGG - Intronic
944676904 2:202041158-202041180 CTGTCAACATAGTTGGAGTAAGG + Intergenic
946345337 2:219105431-219105453 CTGTCAAAATGGATGTGGCAGGG - Intronic
947022730 2:225699375-225699397 CTGTGACAATGGAAGGAACAAGG + Intergenic
947624983 2:231613663-231613685 CTGTAAACCTGGCTGGAGCCGGG - Intergenic
948014865 2:234680256-234680278 CTGTGAACTTGGCTGGGGCATGG - Intergenic
948043480 2:234924009-234924031 GTGGGAACATGGATGGAGCTTGG - Intergenic
948188474 2:236040452-236040474 CTGTGAATACGCATGGACCATGG - Intronic
948572425 2:238926082-238926104 CTGTGTACCTGGGAGGAGCATGG - Intergenic
948572880 2:238928289-238928311 CTGGGAATGTGGAGGGAGCAGGG + Intergenic
1170391959 20:15884898-15884920 CTGTGTCCATGCATGGAGGAAGG + Intronic
1170615252 20:17943505-17943527 CTGGGAACAGGGCTGGAGTATGG + Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171415718 20:24979306-24979328 CAGAGAAGATGGAAGGAGCAAGG + Intronic
1171878244 20:30598079-30598101 CTTTGAACATGGAAGGGGCCAGG - Intergenic
1171902791 20:30872635-30872657 CAGGGACCATGGATGGAGCTGGG - Intergenic
1172780837 20:37436222-37436244 ATGGGAACATGGATGGATGATGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175756171 20:61531685-61531707 GCGTGGACATGGATGCAGCACGG + Intronic
1178006515 21:28226758-28226780 CAGTAAACCTGGATGGATCAGGG - Intergenic
1179593245 21:42425252-42425274 CTGTGAACATGGGTGACGGAAGG - Intronic
1179677040 21:42990308-42990330 CTGTGAACATGGATGTTTCCAGG - Intronic
1179712830 21:43272974-43272996 CAGTGAACATCCAGGGAGCAGGG - Intergenic
1182733248 22:32512166-32512188 CTGGGAACCTGGATGGATCTTGG + Intergenic
1184252942 22:43271206-43271228 CTATGAGCAAGGAGGGAGCAGGG - Intronic
1184425347 22:44405980-44406002 CTGTGAACATGGAGGAGGCTGGG - Intergenic
1184500362 22:44867919-44867941 TTCAGAACATGGATGGTGCAGGG + Intergenic
951465511 3:22996917-22996939 ATGGGAACATGGATGGATCAGGG - Intergenic
951792765 3:26504588-26504610 CTCTGAGCAAGGACGGAGCAAGG - Intergenic
952645185 3:35648638-35648660 CTGTGAACATGGCCAGAGGAGGG + Intronic
952933366 3:38376530-38376552 CTGTGAACGGGGATGCACCAGGG - Intronic
953837035 3:46355784-46355806 CTGTGAAGATCAATGGAGTAAGG - Intronic
953915070 3:46913892-46913914 CTGTGGACAGGGTTGGAGCCAGG + Intergenic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954536389 3:51362295-51362317 CGGTGACCATGGAGGAAGCAGGG - Intronic
955103479 3:55874296-55874318 CTTTGTACATGGAAGGAGTATGG + Intronic
956211767 3:66808998-66809020 CTGTGAACAGGGAAGGAGAGCGG - Intergenic
956381749 3:68671529-68671551 CTGTGAACATTGCTAGAACAAGG - Intergenic
958741475 3:98078795-98078817 CTGAAAACATCCATGGAGCAGGG - Intergenic
959273807 3:104250204-104250226 GTGTGGAAATTGATGGAGCAAGG - Intergenic
960797916 3:121507888-121507910 CTGTCACCAAGGCTGGAGCATGG + Intronic
961165426 3:124760215-124760237 ATGTGAACATGCCTGGAGCTGGG - Intergenic
964142245 3:153417286-153417308 CTGTGAACCTGCATGGTCCAGGG + Intergenic
964529881 3:157655990-157656012 GTGGAAACATGGATGGAGCTGGG - Intronic
964898789 3:161631651-161631673 CTGTGTAATTGGATGGAGCAAGG - Intergenic
967334116 3:188323394-188323416 CTGTGAAGATGCATGGTGAACGG - Intronic
971144238 4:23959682-23959704 CTATGAAGATGGAAGGAGAAAGG + Intergenic
973053043 4:45618242-45618264 TTGTGAATATGGACAGAGCACGG - Intergenic
975181407 4:71350003-71350025 CTGAGGACATGTATGGAGAAAGG + Exonic
975848847 4:78551633-78551655 CTGTGTACAGGGATAGAGCCCGG + Exonic
978275991 4:106950597-106950619 AGATGAACATGGCTGGAGCAGGG - Intronic
983472793 4:168177047-168177069 CTCTTAACATAGTTGGAGCAAGG + Intronic
984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG + Intronic
984901218 4:184588136-184588158 CTCTGAAAGTGGATGCAGCAAGG - Intergenic
987378485 5:17260512-17260534 TTGTGATCATGGATGGCGCCTGG + Intronic
987911064 5:24146193-24146215 CTTTGAAGATGGATGGTGTAGGG - Intronic
990442304 5:55859095-55859117 CTGTGGGCATGCATAGAGCATGG + Intronic
991029771 5:62070840-62070862 CTGTCCACCTGGAAGGAGCACGG + Intergenic
991095492 5:62735589-62735611 CTGTCAGCCTGGGTGGAGCAGGG + Intergenic
991309958 5:65227056-65227078 CTGTGAACTTGGCTTTAGCATGG + Intronic
992225221 5:74613849-74613871 ATTTGGTCATGGATGGAGCAGGG - Intergenic
993702580 5:91135819-91135841 CTGTGAACAGGGATTGTGCAGGG + Intronic
994564858 5:101430736-101430758 TTGGGAACATGGATGGAGTTGGG + Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
996244546 5:121245184-121245206 TTGTCAACATGAATGGATCATGG + Intergenic
996313736 5:122137664-122137686 AGATGAACATGGATGGAGCATGG + Intronic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
998329006 5:141306881-141306903 CTCACAACATGGATGGAGCTGGG + Intergenic
1000569595 5:162895621-162895643 CGCTGAACCTGGATAGAGCAGGG + Intergenic
1000912996 5:167044935-167044957 CAGAGAAAATGGAGGGAGCAAGG + Intergenic
1005286505 6:24333243-24333265 CTGGGAACCTGGATGGAACTTGG - Intronic
1005316431 6:24606928-24606950 CTGGGAAGATGGAAGGAGCTGGG + Intronic
1005848078 6:29798160-29798182 CTTTGAAAATGGAGGGATCATGG + Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006682774 6:35809059-35809081 CTGGGAACAGGGAGGGGGCAGGG + Intronic
1007040122 6:38714163-38714185 CTATTAATATGGATGGACCATGG + Intergenic
1007497443 6:42269718-42269740 CTGTGAACGTGGCTGGAGCCAGG + Exonic
1012432178 6:99175450-99175472 CTGTCATCATTGATGGAGGATGG + Intergenic
1012856276 6:104505977-104505999 CTGTGATCATGGAAGGAGCCTGG - Intergenic
1014690980 6:124563521-124563543 CTGTGGACATGGAAATAGCAGGG - Intronic
1018443112 6:163831573-163831595 CTGTGAACATGGAAGCCGCATGG - Intergenic
1018561239 6:165102759-165102781 GTGTGTAGATGGATGGAACATGG - Intergenic
1018568995 6:165187069-165187091 CTGTCAACATGTTTGGGGCAGGG - Intergenic
1019833291 7:3355588-3355610 CCGTGAAGATGGAGGGAACAGGG - Intronic
1020313585 7:6888042-6888064 CTGGGACCATGGAGAGAGCACGG - Intergenic
1020943363 7:14568547-14568569 CTGTCAAGATGGAAGGAGCCTGG + Intronic
1021607150 7:22419647-22419669 CTGTCAACATGGATCCGGCAGGG - Intronic
1021710390 7:23410460-23410482 GGGTAAACATGGAGGGAGCAGGG + Intronic
1024014580 7:45300522-45300544 CCATGAACATGGGTGGAACATGG - Intergenic
1026734641 7:72941988-72942010 CTGGTACCATGGATGGAGCAGGG - Exonic
1026784977 7:73296900-73296922 CTGGTACCATGGATGGAGCAGGG - Intergenic
1027109101 7:75423030-75423052 CTGGTACCATGGATGGAGCAGGG + Exonic
1029939046 7:104460144-104460166 ATGGGAACATGGATGGAGCTGGG - Intronic
1030092027 7:105866180-105866202 CTGTGAACATTAATGGTGTAAGG - Intronic
1030200443 7:106897675-106897697 GCGGGAACATGGATGGAGCTGGG - Intronic
1034442242 7:151091745-151091767 CTGAGACCCTGGATGGAGCAGGG - Intronic
1034516568 7:151585522-151585544 CTGAGAACAGGGAGGGAGAATGG - Intronic
1035403160 7:158581331-158581353 CAGTGAACATGGAAGGCTCAGGG + Intronic
1035600508 8:894472-894494 GTGGAAACATGGATGGAGCTGGG + Intergenic
1036376499 8:8204933-8204955 CTGTGTCCATGGATCGACCATGG + Intergenic
1036835402 8:12060528-12060550 CTGTGAGCAGGGCTGCAGCAGGG + Intergenic
1038382334 8:27107623-27107645 CTGTAAACATGTAAGGAGCCAGG - Intergenic
1039743507 8:40403258-40403280 CTGTGAACATGGGTGCTCCATGG + Intergenic
1040551181 8:48438846-48438868 CTGTGGACATGGAAAGAGCTGGG + Intergenic
1041391419 8:57350382-57350404 CTCTGAACATGGTTGGAGTAGGG - Intergenic
1042725241 8:71868207-71868229 CTGTGACACTGGCTGGAGCAGGG + Intronic
1045582032 8:103492532-103492554 ATAGGAACATGGATGGAGCTGGG + Intergenic
1046485128 8:114877384-114877406 CTCTGAAAGTGGATGAAGCAAGG + Intergenic
1046876947 8:119265732-119265754 CTAAGAACATGGATGGAGGCTGG - Intergenic
1047415530 8:124661900-124661922 ACGTGAAGATGAATGGAGCATGG - Intronic
1048573722 8:135675220-135675242 CTGTTATCTTGGATGGAGCAAGG + Intergenic
1049590967 8:143462331-143462353 CTGTGACCATGGGTGGAGACTGG + Intronic
1049701857 8:144018700-144018722 CTGAGAGCAAGGATGGAGCGGGG + Intronic
1049804498 8:144532775-144532797 CTGTGAACAGGGATGGCACAGGG - Intronic
1052597012 9:30574537-30574559 CTGGGAGCATGGTGGGAGCATGG - Intergenic
1053318928 9:37078449-37078471 CTGTCACCCAGGATGGAGCACGG + Intergenic
1055307244 9:74942680-74942702 CTTTGAAGATGGAAGGAGCCAGG - Intergenic
1057228025 9:93302667-93302689 CTGTGCCCAGGGATAGAGCAGGG + Intronic
1057266783 9:93622550-93622572 CTTTGAACATGGAAGGGGCCGGG + Intronic
1057443863 9:95100018-95100040 CTGTGGACATGGTGGCAGCAGGG - Exonic
1059725284 9:117002780-117002802 CTGTAAACTTTGCTGGAGCAAGG - Intronic
1060345035 9:122808533-122808555 CTGTGCACATGCAGAGAGCAAGG + Intronic
1060946939 9:127575190-127575212 CTGTGAGGTGGGATGGAGCAGGG - Intronic
1061672046 9:132194298-132194320 CTGTGAGCCTGGATGCAGAATGG - Intronic
1186785038 X:12949250-12949272 CTTTGAAGATGGAGGAAGCAAGG + Intergenic
1187155965 X:16720596-16720618 CTGTAAACTTGGAAAGAGCACGG - Intronic
1189157853 X:38777878-38777900 CTTTGACCGTGGATGGAGCAGGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1193523788 X:82563705-82563727 GTGGGAACATGGATGAAGCTGGG + Intergenic
1193647651 X:84088854-84088876 CAGTGAACAGGGATAGATCAGGG + Intronic
1195172986 X:102286756-102286778 CATTGAAAATGGATGGAGGAAGG - Intergenic
1195185880 X:102400339-102400361 CATTGAAAATGGATGGAGGAAGG + Intronic
1195343417 X:103926302-103926324 GTGGGAAAATGGATGGAGCAGGG + Intronic
1195343434 X:103926382-103926404 GTGAGGATATGGATGGAGCAGGG + Intronic
1195343475 X:103926537-103926559 GTGGGGATATGGATGGAGCAGGG + Intronic
1195363493 X:104106782-104106804 GTGGGGAGATGGATGGAGCAGGG - Intronic
1195363536 X:104106969-104106991 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365049 X:104116993-104117015 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365073 X:104117111-104117133 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365093 X:104117191-104117213 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365113 X:104117271-104117293 GTGATAAAATGGATGGAGCAAGG - Intronic
1195541489 X:106068031-106068053 ATGTGCACATGGATGCTGCAGGG + Intergenic
1197552474 X:127910084-127910106 GTATGAACATGGATGGAGCTGGG + Intergenic
1199012793 X:142777293-142777315 CTGTAGACATGAATGGAACATGG + Intergenic
1200009979 X:153113646-153113668 CTGGGACCATGGATGGGGCCAGG + Intergenic
1200029621 X:153286276-153286298 CTGGGACCATGGATGGGGCCAGG - Intergenic
1200255316 X:154578899-154578921 GTGGGAAGATGGATTGAGCATGG + Intergenic
1200262453 X:154625505-154625527 GTGGGAAGATGGATTGAGCATGG - Intergenic
1200943963 Y:8813336-8813358 CTGTGAACATTGAGGCAGAAAGG + Intergenic
1201704529 Y:16921616-16921638 CTTTGAACATGAATGGGGGATGG - Intergenic
1201736422 Y:17267595-17267617 GTAGGAACATGGATGGAGCTGGG + Intergenic