ID: 1146410500

View in Genome Browser
Species Human (GRCh38)
Location 17:32579538-32579560
Sequence TTTAAGGTATACAATTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 5, 2: 11, 3: 46, 4: 347}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146410500 Original CRISPR TTTAAGGTATACAATTTGAC AGG Intronic
901949345 1:12729329-12729351 TTTAAGAAATACAATTTGTAAGG - Intergenic
903745314 1:25582774-25582796 TTTAAAGTATACAATGAGCCGGG + Intergenic
904215946 1:28919434-28919456 TTTAAGGATAGCAATTTGACTGG - Intronic
904580795 1:31542395-31542417 TTTAAGAAATACAATTTGTAAGG - Intergenic
905966276 1:42099215-42099237 TTTAATGTATACAATTTTATAGG - Intergenic
908231492 1:62109849-62109871 CTTAAAGTGTACAATTTGATAGG - Intronic
908595195 1:65681162-65681184 TTTATGGCATACAGTTTGATGGG - Intergenic
908697762 1:66864190-66864212 ATTAATGTATACAATTTGACAGG - Intronic
909088025 1:71190985-71191007 TTAATGGTATCCAATTTTACTGG + Intergenic
910412093 1:86957016-86957038 TATAAGGTACAAAATATGACAGG - Intronic
910454660 1:87384608-87384630 TTCAAGGAAAACAATTTTACTGG + Intergenic
910640737 1:89458761-89458783 TTTATTATATACAATTTGATAGG - Intergenic
910680411 1:89857931-89857953 TTTAAGGTATAGCCTTTGCCAGG + Intronic
911503010 1:98712322-98712344 TTTAAGAAATACATTTTGTCAGG - Intronic
912373891 1:109194594-109194616 GGTAAGGTATACCAGTTGACAGG + Exonic
913009191 1:114666145-114666167 GTGAAGGTGTAGAATTTGACAGG - Intronic
913610107 1:120502608-120502630 TTAAACGAATACAATTTGCCAGG - Intergenic
913681901 1:121194131-121194153 TTTAAGGTATACAATTTGATAGG + Intronic
914033737 1:143981755-143981777 TTTAAGGTATACAATTTGATAGG + Intergenic
914155710 1:145086217-145086239 TTTAAGGTATACAATTTGATAGG - Intronic
915961152 1:160267865-160267887 TTTGAAGTATACAATTGGCCAGG + Intergenic
919129410 1:193434317-193434339 TTTAATGAATACAATCTGATGGG - Intergenic
919696880 1:200586354-200586376 TTTAAGTTATACAATGTTATGGG - Intronic
920276614 1:204810802-204810824 TTTAATGTATCCATTCTGACTGG - Intergenic
920469217 1:206212640-206212662 TTTAAGGTATACAATTTGATAGG + Intronic
920684706 1:208100656-208100678 TTTAAAATATACCATGTGACAGG - Intronic
921311475 1:213848176-213848198 TTTAAAGTATACAATTCAATGGG + Intergenic
922882002 1:228988098-228988120 TTTAAGGTAAAAAATGTGCCAGG + Intergenic
922961774 1:229653332-229653354 TTTAAAGTATAAAATTTAATGGG + Intronic
923670295 1:236034753-236034775 TTTAAAGTATACAATTTGGTGGG - Intronic
923725487 1:236501971-236501993 CTTAAGGTATCAAATTTTACTGG + Intergenic
924380828 1:243462771-243462793 TTCTAGGTAAACAATTTCACTGG - Intronic
1064000603 10:11660957-11660979 TTTAAAGTGCACAATTTGACTGG - Intergenic
1064268106 10:13841257-13841279 TTTAAAATAAAGAATTTGACTGG + Intronic
1065301522 10:24325997-24326019 TTTTAGGTATACCAGTTAACAGG + Intronic
1066055619 10:31677847-31677869 TTGAAGGTATACACCCTGACCGG + Intergenic
1066670652 10:37834854-37834876 TTTAAGATATAGAATAGGACGGG + Intronic
1068485981 10:57658883-57658905 TTTAAGCTATTCAATTTGTATGG - Intergenic
1069619911 10:69830769-69830791 TTTAAAGTGTACAATTTGATGGG + Intronic
1071317629 10:84418073-84418095 TTTATGGTATACAATGTTATTGG - Intronic
1072811305 10:98464257-98464279 TTTAAGGAATAGATTTTGAAAGG + Intronic
1073487778 10:103831526-103831548 TTTAACGTGTACAATTTGGCTGG + Intronic
1073644433 10:105285142-105285164 TTTAAAGTGCACAATTTGATAGG + Intergenic
1074136772 10:110634359-110634381 TTAGAGGAATACAAATTGACAGG + Intergenic
1074354685 10:112771581-112771603 TTTAAAGTATACAATTCAATGGG + Intronic
1074582955 10:114737983-114738005 TTTAAAGCATACAATTTGATGGG - Intergenic
1076437841 10:130458946-130458968 TTTAATGTGTACAACTTGATGGG - Intergenic
1076607348 10:131697446-131697468 TTTAATGTATATAATGTGATGGG - Intergenic
1077583489 11:3433080-3433102 TTTAAAGTGTACAATTTGGCCGG + Intergenic
1079929740 11:26543137-26543159 TTTATGGTATAGATTTTGACAGG - Intronic
1080293130 11:30693777-30693799 TTTAAAATATACAATGTGACTGG + Intergenic
1080973473 11:37305612-37305634 ATTAAGGAATCCAATATGACTGG + Intergenic
1081145195 11:39555033-39555055 TTTAATGTATACATTTTTATAGG + Intergenic
1081252676 11:40854652-40854674 TTTAATGTATAAAATTTTGCAGG - Intronic
1081902069 11:46637191-46637213 TTGAAAGTATACAATTTAATAGG - Intronic
1084240410 11:67815893-67815915 TTTGAAGTGTACAATTTGGCTGG + Intergenic
1084832028 11:71776952-71776974 TTTAAAGTGTTCAATTTGGCCGG - Intergenic
1085767609 11:79296817-79296839 TTTGGGGTATACAGTTTGAAGGG - Intronic
1086048951 11:82566572-82566594 TTTTAGGCATTCCATTTGACAGG + Intergenic
1086905263 11:92411478-92411500 TGTAAGAAATACAATTTCACAGG + Intronic
1088276586 11:108093102-108093124 TTTAAAGTATACAATTTGGCTGG - Intronic
1088687183 11:112294788-112294810 TTAAAGGTAAACAATGTGCCAGG - Intergenic
1088757327 11:112896558-112896580 TTTAGTGTATACGATTTGATGGG + Intergenic
1089162480 11:116450043-116450065 TTTAAAATATACAATTTGGTGGG - Intergenic
1089661275 11:119987294-119987316 GTTTAGGTATACATTTTGAGTGG + Intergenic
1090013606 11:123065596-123065618 TTTAAGGTTTAGAATTTAATTGG + Intergenic
1090923284 11:131227436-131227458 TTTATGGTATATATTTTGAATGG + Intergenic
1092114290 12:5987937-5987959 TTTAAAGTGTACAATTTGATAGG - Intronic
1093626871 12:21360271-21360293 TTTAAAATGTATAATTTGACTGG - Intronic
1093869478 12:24270420-24270442 TTTAATTTATACTATTTGCCAGG + Intergenic
1094067589 12:26377866-26377888 TTTAAGATACACACTTTGCCTGG + Intronic
1094768820 12:33629193-33629215 TTTATCTTGTACAATTTGACAGG + Intergenic
1095243565 12:39890216-39890238 TTTAAGGTAAACAAATGGCCAGG - Intronic
1095321703 12:40836775-40836797 TTTAATGAACACAATTTGAAAGG + Intronic
1095755778 12:45765717-45765739 TATAAAGTATACAATTTGGTAGG + Intronic
1096632960 12:52941002-52941024 TTTTAGGTATACAGTTTGATGGG - Intronic
1096641363 12:52997011-52997033 TTGAAAGTATACAATTGGCCAGG + Intergenic
1097511989 12:60554852-60554874 TTTAGTATCTACAATTTGACAGG + Intergenic
1099587374 12:84535611-84535633 TTTACTGTATACAATTTGATGGG + Intergenic
1099595515 12:84658755-84658777 TTTAAGTTATCCAATGTGATGGG - Intergenic
1100144304 12:91658645-91658667 TGTAAGGAATAAAATTTGACTGG - Intergenic
1101283044 12:103279336-103279358 TTTAATGTATGCATTTTGATGGG - Intronic
1102791822 12:115652785-115652807 CTTAATGTATACAATCTGATGGG + Intergenic
1102806636 12:115787223-115787245 TTTAAGGTTCACAATTTAATTGG + Intergenic
1103874840 12:124118971-124118993 TTTAAAGTATACGATGTGATGGG + Intronic
1104027201 12:125036687-125036709 TTTAACATATACATTTTGAGGGG - Intergenic
1106329398 13:28725524-28725546 TTTAAAGTATACAGTTTTATGGG - Intergenic
1106930225 13:34655257-34655279 ATGAATGTATACATTTTGACAGG + Intergenic
1108975394 13:56437475-56437497 TTTAAGGTATACAATGTTTAAGG - Intergenic
1108994818 13:56715253-56715275 TTTTAAGCATACAATTTGATAGG + Intergenic
1109019334 13:57065728-57065750 TTTAAGGTATAATATTTTAAAGG + Intergenic
1109158246 13:58938782-58938804 TGTAAGGTAAAGAATTTGACAGG + Intergenic
1109191105 13:59325282-59325304 TTTAATGTAAACAATGTTACTGG - Intergenic
1110517722 13:76436201-76436223 TTTAAAGTATACAATGTAAGAGG + Intergenic
1111237182 13:85424358-85424380 TTTAAGGGATCCTATATGACAGG - Intergenic
1111583821 13:90259478-90259500 TTTAAGGTAGGCACTTTGATAGG + Intergenic
1111764047 13:92504051-92504073 TTTAATGCATACAATTGGAAAGG + Intronic
1111797007 13:92934505-92934527 TTTAAGGCATACTATATGCCAGG - Intergenic
1111925660 13:94460928-94460950 TTTAAAGTAGACAATTTGTATGG + Intronic
1112370796 13:98791695-98791717 TTTAATGTATACAATTTGGCTGG - Intergenic
1113555057 13:111226767-111226789 TTTAAGGAATACATTTTGTAAGG + Intronic
1114159009 14:20141791-20141813 TTTAAAGTATACAAATTCAATGG + Intergenic
1116814531 14:49571363-49571385 TTTATAGTAAAGAATTTGACTGG + Exonic
1118427170 14:65678531-65678553 TTTAAGGTCTCCAAGTTGATAGG + Intronic
1118527093 14:66657917-66657939 TTTAAGAAATACATTTTGTCAGG + Intronic
1118692967 14:68357574-68357596 TTTAAGAAATACAATTTGTAAGG - Intronic
1118991215 14:70798794-70798816 TTTAAAGAATAGAATTTGAGTGG + Intronic
1119514639 14:75238577-75238599 TTTAAGGTATAAATTTTGATAGG + Intergenic
1120901904 14:89582667-89582689 TTTAAAGAATGCAATTTGATAGG + Intronic
1121474813 14:94188896-94188918 TTCAAGATATACAATGTGATGGG - Intronic
1122074650 14:99228364-99228386 TTTCAGGTATTCAAATTGATCGG + Intronic
1122392653 14:101400631-101400653 TGTAAGGTAAACAATTCCACTGG + Intergenic
1122806408 14:104262176-104262198 ATTAAAGTATACAATTGGATAGG - Intergenic
1123984656 15:25634571-25634593 TGTAAAATATACAATTTGATGGG - Intergenic
1125774675 15:42201469-42201491 TTTAAAATGTACAATTTGGCTGG - Intronic
1126391784 15:48164064-48164086 TTTAAGAAATACAATTTGTAAGG + Intronic
1126579682 15:50231444-50231466 TTTAAAGTGTACAATTTGCTAGG - Intronic
1126651515 15:50926884-50926906 CTTAAAGTATACAAGTTGGCCGG - Intronic
1126939433 15:53750559-53750581 TTTAAGCTATACATTTTGTGAGG + Intronic
1127541200 15:59940751-59940773 TTGAATCTATACGATTTGACTGG + Intergenic
1127737822 15:61861339-61861361 TTTAATATATAAAATTTTACTGG + Intronic
1127748608 15:62007617-62007639 TTTAAGTCAGACAATTTTACTGG - Intronic
1128141425 15:65303429-65303451 TTTAAAGTATACCATTCGGCCGG - Intergenic
1130002225 15:80057679-80057701 TTTAAAGAATACAATTTGCTGGG - Intergenic
1130166949 15:81471167-81471189 TTTAAGCTTTACAATTTCAATGG + Intergenic
1130206817 15:81884451-81884473 TTTAAGGTAGGAAATATGACTGG + Intergenic
1131766527 15:95681538-95681560 TTTAAGTTATAATATTTGTCTGG - Intergenic
1133351857 16:5106630-5106652 TTTAAAGTGTACAATTTGGCCGG + Intergenic
1133969612 16:10558332-10558354 TTCAAGTTCTACAGTTTGACAGG + Intronic
1134218791 16:12337315-12337337 TTTAAGGTATGCAATGCGATGGG + Intronic
1134389511 16:13806470-13806492 TTTCACATATACAACTTGACAGG - Intergenic
1134788666 16:16968424-16968446 TTTAAAGTGTACAATTTGATAGG + Intergenic
1135346106 16:21689980-21690002 TTTAAAGTACACAATTGGGCCGG - Intronic
1135648338 16:24183222-24183244 ATAAATGTATACAATTTTACTGG - Intronic
1135709436 16:24702615-24702637 CTTAAAATATACAATTTGGCTGG + Intergenic
1136097636 16:27968810-27968832 TTTAAAGTATGCAATTTGGCTGG + Intronic
1136469417 16:30469268-30469290 TCTAAGGTATACAATTCACCAGG + Intergenic
1136757667 16:32698466-32698488 TGTATGGTATAAAAATTGACAGG + Intergenic
1136810439 16:33171909-33171931 TGTATGGTATAAAAATTGACAGG - Intergenic
1136816915 16:33281989-33282011 TGTATGGTATAAAAATTGACAGG - Intronic
1138740448 16:59303064-59303086 TTTGGGGAACACAATTTGACTGG - Intergenic
1139711279 16:68778339-68778361 TTTAAAGTGTACAATTGGTCGGG - Intronic
1140087017 16:71806149-71806171 TTTAAAGTACAGAATTTGCCAGG - Intronic
1140290991 16:73657158-73657180 TTTAAAATGTACAATTTGGCTGG + Intergenic
1141458598 16:84162304-84162326 TTTAAAGTGTACAATGTGGCTGG + Intronic
1203059816 16_KI270728v1_random:958815-958837 TGTATGGTATAAAAATTGACAGG + Intergenic
1142526740 17:547909-547931 TTTAAAGTATACAGTTGGCCAGG - Intronic
1142703335 17:1677982-1678004 TTTCATGTATACATTTAGACAGG - Intronic
1142892495 17:2953548-2953570 TTTAAAGTGTACAATTTGGCCGG + Intronic
1143072451 17:4308055-4308077 CTTAAATTATACAATTTGGCCGG + Intronic
1143605101 17:7979175-7979197 TTTTAAGTGTACATTTTGACGGG + Intergenic
1144995779 17:19267349-19267371 TTTAAAGTATACGATTCAACGGG - Intronic
1146410500 17:32579538-32579560 TTTAAGGTATACAATTTGACAGG + Intronic
1147058809 17:37857178-37857200 TTTAAGAAATACATTTTGAAAGG - Intergenic
1147433917 17:40394627-40394649 TTTAACGTATACCATTTGGCTGG - Intronic
1151270182 17:72988154-72988176 TTTAAAGTGTACAATTAGGCTGG + Intronic
1151446386 17:74167765-74167787 TTTAATGTATACAACTGGATTGG - Intergenic
1152171895 17:78756370-78756392 TTTAAAGTGTACAGTTTGGCTGG - Intronic
1152493162 17:80651582-80651604 TTTAAAGTGTACAACTTGGCTGG + Intronic
1153328428 18:3846906-3846928 TTTAAAGTAGACAATTTAATGGG - Intronic
1153627713 18:7037735-7037757 TTTAAGGTAAACAGTATGTCCGG - Exonic
1153711164 18:7800538-7800560 TTTAAGGCACCCAGTTTGACAGG + Intronic
1155369778 18:25085964-25085986 TTTAAAGTATACAATTTATTTGG - Intronic
1157245210 18:46047703-46047725 TTTTAAGTATATAATTTGATAGG - Intronic
1157658804 18:49420493-49420515 TTTATTGTATACAATTGGATTGG - Intronic
1158803385 18:60940657-60940679 TTTAATGTATACAGTTTGACGGG + Intergenic
1159762161 18:72441107-72441129 TTTAAGGTTTATAATCAGACGGG + Intergenic
1159976389 18:74718091-74718113 TTTAAAGTATACATTTTGATGGG + Intronic
1160336242 18:78042864-78042886 TTTAAGGTATAAAAGCTGAGTGG + Intergenic
1162243916 19:9383001-9383023 TTTAAAGAAAACAATTTGGCTGG - Intergenic
1163050625 19:14680774-14680796 TTTAAGGTACACCATTGGCCGGG + Intronic
1165203857 19:34167408-34167430 TTTAAAGTATACAATTTAGTGGG + Intergenic
1166222191 19:41372633-41372655 TTTAAGTTATGCATTTTGGCAGG + Intronic
925983489 2:9196012-9196034 TTTAAAGTGTACAACTTGGCTGG + Intergenic
928039000 2:27854817-27854839 TTTAATGTATACATTTTGATGGG + Intronic
928939396 2:36712540-36712562 TTTAAAGTGTATAATTTGGCCGG + Intronic
930118049 2:47736759-47736781 TGTGAGTTATACAATTTGGCTGG + Intronic
930899595 2:56487743-56487765 TTTAAGAAATACATTTTGAAAGG + Intergenic
931366464 2:61623434-61623456 TTTAAAGTACGCAATTTGGCGGG + Intergenic
931563103 2:63585079-63585101 TTTAAACTATAACATTTGACTGG - Intronic
931602276 2:64016903-64016925 TTTAAGGTGTACCACTTGGCCGG - Intronic
932097991 2:68868875-68868897 TTTAAAGTGTATAATTTGAAAGG - Intronic
933192831 2:79355475-79355497 TTTAAAGTATACAATTTAACTGG + Intronic
934194603 2:89828888-89828910 TTTAAGGGATTCAACTTGAATGG - Intergenic
934731839 2:96663744-96663766 TTTAAAATGTACAATTTGGCTGG + Intergenic
935587348 2:104813637-104813659 TATAAGGTATACAAGTGCACAGG - Intergenic
936443417 2:112576205-112576227 TTTAATGAATACAATTTGATGGG + Exonic
940196365 2:151099216-151099238 TTTAAGGTATCAAATTTAAGTGG - Intergenic
941167599 2:162099564-162099586 TTTAGGGTATATACTTTCACTGG - Intergenic
942259513 2:174144436-174144458 TCTAGGGTATTCCATTTGACAGG - Intronic
942571514 2:177320121-177320143 TTTAAGGCATAAAATTCGGCTGG - Intronic
942793239 2:179785401-179785423 TTTAAGAAATACATTTTGAAAGG + Intronic
943308137 2:186292628-186292650 TTAAATATATACAATTTGATGGG - Intergenic
943508311 2:188791146-188791168 TATAAGGTAAACAATGTTACAGG - Intergenic
946167375 2:217873140-217873162 TTTAAAGTATACAATTCAATGGG - Intronic
947076090 2:226347687-226347709 TTTAATGTATACAATTGGCTGGG + Intergenic
1170187308 20:13605286-13605308 TGTAAAGTGTACAATTTGATGGG - Intronic
1170258851 20:14379393-14379415 TTTAAAGTATACAATTCGATGGG + Intronic
1170541517 20:17393268-17393290 TTTAAGATACAAAATTTGATGGG - Intronic
1173153264 20:40585930-40585952 TTGAGGGTCTACAATTTGCCAGG - Intergenic
1173962609 20:47086688-47086710 ACTAAGGATTACAATTTGACAGG + Intronic
1174262666 20:49307983-49308005 TTTAAAGTATATAACTTGATTGG + Intergenic
1175207229 20:57320622-57320644 TTTAAAGTATACAATTCAATGGG - Intergenic
1177437855 21:21080193-21080215 TTTAATGTATACAATTTGATGGG - Intronic
1181677175 22:24463030-24463052 TTTAGGGGAGACAATTTGATAGG - Intergenic
1181754547 22:25014118-25014140 TTTAAGGTTCACTAATTGACAGG + Intronic
1182731266 22:32496794-32496816 TTTAAGAAATACATTTTGTCAGG + Intronic
1184364797 22:44043671-44043693 TTTAAAGTGTACAATTCGGCTGG - Intronic
1185329815 22:50247427-50247449 TTTAAAGTATACATTTAGGCAGG - Intronic
949660728 3:6275480-6275502 TATTAGGTGTCCAATTTGACTGG - Intergenic
949984501 3:9529441-9529463 TTTAAGAAATACATTTTGAAAGG - Intronic
950580562 3:13859216-13859238 TTTAAGGTTTACAAGATGACAGG + Intronic
951699233 3:25478177-25478199 TTTAACCAATAGAATTTGACAGG - Intronic
952769340 3:36983561-36983583 TTTAAAGTAGAAAATTTGATTGG - Intergenic
953174614 3:40538687-40538709 TTTAAGGAATACATTTTGTAAGG + Intronic
956828533 3:73021545-73021567 TTAAATGTATACCATGTGACAGG + Intronic
957259179 3:77878252-77878274 TTCAAGGTATCCATCTTGACAGG - Intergenic
957518535 3:81288669-81288691 TTTAAGGAATACATTTTGTAAGG - Intergenic
957960312 3:87241332-87241354 TTTCAGGTGTACAATTTGATAGG + Intronic
958051055 3:88346835-88346857 TTTAAGGAATACATTTTGTGAGG + Intergenic
958485971 3:94709430-94709452 TTTGAGGTTTACAGTTTGATGGG - Intergenic
958590238 3:96148804-96148826 ATAAAGCTATACAATTTGAGAGG + Intergenic
959077967 3:101771143-101771165 TTTAAAGTGGACAATTTGGCTGG + Intergenic
959828172 3:110826618-110826640 TTTAACTTATATAATTTGATGGG - Intergenic
959934290 3:112013333-112013355 TTCAAGATATGCAATTAGACAGG - Intronic
960303038 3:116027492-116027514 TTTAAGCAATAGAAATTGACTGG - Intronic
960522611 3:118672891-118672913 TTTAAGTTTTACAATTTTAAAGG - Intergenic
960573693 3:119209082-119209104 TTTAAGTTATAGAATGTGATTGG + Intergenic
960921362 3:122749904-122749926 TTTAAGATATCAAATTTGGCCGG - Intronic
961298513 3:125906045-125906067 TTTCAAGTGTACAATTTGGCCGG - Intergenic
961979249 3:131059285-131059307 CTTAATGTATACAATTTGATGGG - Intronic
962033608 3:131627528-131627550 TTTAAGGAATACATTTTGTAAGG + Intronic
963293098 3:143513665-143513687 TTTAAGGAATACATTTTGCAAGG - Intronic
963613213 3:147499036-147499058 TCTGTAGTATACAATTTGACTGG + Intronic
964491534 3:157241611-157241633 TTTAATTTATACAATCTGAGTGG + Intergenic
964606605 3:158566711-158566733 TGTAATGTATATGATTTGACTGG - Intergenic
965003852 3:162990636-162990658 TTCAAGGTATAAATTTTGAGGGG + Intergenic
966111515 3:176408340-176408362 TTGAAGGCATTCAATTTCACAGG + Intergenic
966164738 3:177005101-177005123 TTTGTGGTATACAATTTGATGGG - Intergenic
966900345 3:184478942-184478964 TTTTAAGTGTACAATTTGATGGG + Intronic
967342564 3:188416240-188416262 TTTAAGCCATACATTTTGGCAGG - Intronic
969815218 4:9681966-9681988 TTTAAAGTGTACAATTTGGCCGG - Intergenic
970538056 4:17049897-17049919 TTTAAGAAATACATTTTGGCTGG - Intergenic
971712200 4:30129012-30129034 ATTAGGGATTACAATTTGACAGG - Intergenic
971868702 4:32207539-32207561 TTTAAGGAATACATTTTGTAAGG + Intergenic
972051868 4:34745189-34745211 TTTAAAGTGTACAATTTAATGGG - Intergenic
972181843 4:36476260-36476282 TTGAAGGAATACAACTTCACAGG + Intergenic
973230418 4:47834726-47834748 TTTAATGTAAACAATGTGATAGG - Intronic
973594818 4:52477119-52477141 TTTAAAGTGTACAATTTAATGGG - Intergenic
973859992 4:55054068-55054090 TTTAATATATACATTTTGAAGGG - Intergenic
974142233 4:57902021-57902043 ATTAATGTATACAATTTTATAGG + Intergenic
974432767 4:61818597-61818619 ATTAGGGATTACAATTTGACAGG + Intronic
975223601 4:71843256-71843278 TTAAAGGTATAATATTTGAAGGG + Intergenic
976502109 4:85803096-85803118 ATTAAGGTATATAAATTGTCTGG + Intronic
976885276 4:89975575-89975597 TTTAAGGAATACATTTTGTAAGG - Intergenic
977724789 4:100283578-100283600 TTTAAGGGAAACATTTTAACAGG - Intergenic
977910927 4:102535150-102535172 TTTAAGGGATAAAATTTCACTGG - Intronic
978293953 4:107181292-107181314 TTTAAAGTGTACAGTTTGATGGG - Intronic
978500668 4:109406594-109406616 TTTAAGGAATGCAATTTGTGTGG + Intergenic
979002717 4:115245690-115245712 TTAAAAGTATTTAATTTGACTGG - Intergenic
979040311 4:115782830-115782852 GTTAAGGTATGCAATTGGAGAGG + Intergenic
979386262 4:120068342-120068364 TTTAAGGAAAAAAATTTTACTGG - Intergenic
979783280 4:124682825-124682847 ATTAAAGGATAGAATTTGACTGG - Intronic
980042054 4:127951140-127951162 TTTAAAGTATACAATTCAATGGG + Intronic
980272180 4:130598829-130598851 TTTATAGTATACAATTTGATAGG - Intergenic
980458061 4:133070516-133070538 TTTGAAGTGTAGAATTTGACAGG - Intergenic
981765579 4:148245209-148245231 TTTAATGTCTACAATGTGCCAGG + Intronic
981794435 4:148580176-148580198 TACAAGGTATACAAGGTGACTGG + Intergenic
982024841 4:151241689-151241711 TTTAAAGTGTACAATTTAGCTGG - Intronic
982584298 4:157218796-157218818 TGTAAGGTATACAAAATGATTGG - Intronic
983103924 4:163661648-163661670 TTTAAAGCATACAATTTAATAGG + Intronic
983970497 4:173865487-173865509 TTTAAGGTACACAATTAAATGGG - Intergenic
984534121 4:180951975-180951997 TTGAAGTAATACAATTTTACTGG - Intergenic
985065972 4:186122306-186122328 TTTAAAGTATGGAATTTGATTGG + Intronic
987875712 5:23677750-23677772 TTTATAGTATACAATATGATGGG - Intergenic
988104453 5:26725863-26725885 TTTAAGATAAATAATTTGGCCGG - Intergenic
988188048 5:27892200-27892222 TTTCAGATATGCAATTTGATTGG + Intergenic
988465286 5:31484677-31484699 TTTACTTTATACAGTTTGACAGG - Intronic
989047196 5:37284554-37284576 TTTAAAATATCCAATTTGGCTGG + Intergenic
989189688 5:38658676-38658698 GTTAAGGTATACAATTTGATAGG - Intergenic
989773158 5:45169036-45169058 TTTAATGTGTACAATTTGATTGG + Intergenic
990219399 5:53571094-53571116 TATAAAGTATACAATTTGACTGG + Intronic
990553566 5:56908878-56908900 TTTAAAGTGAACAATTTGATAGG - Intergenic
990862837 5:60347060-60347082 TTTAAGGCAGACAATTAAACAGG + Intronic
991774624 5:70072824-70072846 TTGAAAGTATACAAGTTGGCTGG + Intronic
991853918 5:70948249-70948271 TTGAAAGTATACAAGTTGGCTGG + Intronic
991942801 5:71869495-71869517 TTTAAGGTATAAAAATGGAGAGG - Intergenic
993400383 5:87442402-87442424 TTTAGGAAATACACTTTGACAGG - Intergenic
993838509 5:92846358-92846380 TGTAAGGCATTCCATTTGACTGG - Intergenic
994247619 5:97498426-97498448 GTTAATGTATACAATTTAATGGG - Intergenic
994330520 5:98500179-98500201 TTTAAGGTAGTGAAGTTGACAGG - Intergenic
995328792 5:110923007-110923029 TTTAAGGTATACACTTCTATAGG + Intergenic
995345916 5:111117308-111117330 TTTAAGGTTTACATTTTTATTGG + Intronic
996348003 5:122508483-122508505 TGTGATATATACAATTTGACAGG - Intergenic
996564075 5:124861632-124861654 TTTAAAGTATACAATTTAGTGGG - Intergenic
997223100 5:132186392-132186414 TATAATGTATATAATTTGATAGG - Intergenic
998553012 5:143095247-143095269 TTTAAAGTATACAATTCAATGGG + Intronic
998919109 5:147048157-147048179 TTTAAGGTATACAGTCTAGCAGG - Intronic
1000193050 5:158931204-158931226 TTTAAGTTATAAAATGTGATGGG - Intronic
1000729744 5:164818780-164818802 TTTAAGGTTTACATTATGTCAGG + Intergenic
1000863310 5:166482935-166482957 TTTAAGAAATACATTTTGAAAGG - Intergenic
1002034315 5:176454888-176454910 TGTCAGGAATACAACTTGACTGG - Intronic
1002182672 5:177439240-177439262 TTTAAAGTGTACAATTCGGCTGG + Intronic
1003807230 6:9738609-9738631 TTTAAGGTCTCCTATTTCACGGG - Intronic
1003964185 6:11237290-11237312 TCTAAGGTATACAACAGGACAGG - Intronic
1004437559 6:15611503-15611525 TTTAAGAAATACAATTTGTAAGG + Intronic
1006537186 6:34709197-34709219 TTTAAAGTGTACAGTTTGGCAGG - Intergenic
1006647887 6:35527639-35527661 TTCAAGATATACAACTTGACTGG - Intergenic
1007739445 6:44002006-44002028 TTTAAAGTATCCAGTTTAACTGG + Intronic
1007767196 6:44167611-44167633 TTTAAAGTGTACCATTTGGCTGG + Intronic
1008121703 6:47624592-47624614 GTTAAGATATACTATTTGAGAGG + Exonic
1008441561 6:51537779-51537801 TTTAATGTGTTGAATTTGACAGG + Intergenic
1009331732 6:62430745-62430767 TTTAAGAAATAAAATTTGATTGG + Intergenic
1009380250 6:63019080-63019102 TTGAAGTTATACTCTTTGACAGG + Intergenic
1009650298 6:66467990-66468012 TTCAATGTATACATCTTGACTGG + Intergenic
1010163685 6:72890155-72890177 TTTAATATATACATTTTGATGGG + Intronic
1011280701 6:85674422-85674444 TAAAAAGTATACAATTTGATGGG - Intergenic
1011756635 6:90505906-90505928 TTTAAAGTGTACAATTTGATAGG - Intergenic
1011913502 6:92472212-92472234 TTTAAAGTGTACAATTTTATGGG - Intergenic
1012104059 6:95130900-95130922 CTTAATGTGTACAATTTCACTGG + Intergenic
1012215205 6:96573925-96573947 ATTACAGTATACAATTTGAAAGG + Intronic
1012614597 6:101261213-101261235 TTTAAATCATACAACTTGACAGG - Intergenic
1014053276 6:116981704-116981726 TTTAAAGTATACAATTTGATAGG - Intergenic
1014620766 6:123664268-123664290 TTTAAGGGATGCAGTTTGTCAGG + Intergenic
1014964537 6:127730654-127730676 TTTAAGGTTTACAACATGAGAGG + Intronic
1016040173 6:139424536-139424558 TTCAGGGTATATAATTTGACAGG + Intergenic
1016857556 6:148686234-148686256 TTTAATGTATACAATTTGATGGG + Intergenic
1018296492 6:162351394-162351416 TAAAAGGTATTCAATTTGACAGG - Intronic
1019456928 7:1133422-1133444 TTTATGGTAAATAATTTGAGAGG - Intronic
1019474833 7:1239044-1239066 TCTAAGGTGAACAATTTGTCTGG + Intergenic
1019875888 7:3810230-3810252 TTCATGGTTTCCAATTTGACTGG + Intronic
1020091139 7:5342041-5342063 TTTAAGGAATATAATTTGTAAGG + Intronic
1022034657 7:26522200-26522222 TTTAAAGTATACAATTGGCCGGG + Intergenic
1023884868 7:44347534-44347556 TTTAAAGTGTACAATTTCAGCGG - Intergenic
1027626850 7:80555685-80555707 TTTGAGGTATATAATTTGTATGG + Intronic
1028829969 7:95316364-95316386 TTTAATGTATACTACTTCACAGG - Intronic
1030053811 7:105563626-105563648 TTTAAAGTGTATAATTCGACCGG - Intronic
1030681142 7:112435530-112435552 TTTAAGGGATATTATTTCACTGG + Intronic
1030765577 7:113405214-113405236 ATTAAGGAGTACAATTTGATGGG - Intergenic
1031426694 7:121614125-121614147 TTCAAGGTATGCAATTTCAGAGG - Intergenic
1032765053 7:134983775-134983797 TTTAAGGTATGAGATTTCACAGG - Intergenic
1034247374 7:149657288-149657310 TTTAAAGTACACAATTTAATAGG - Intergenic
1034704587 7:153129003-153129025 TTTAATGTATGCAATTTGATGGG + Intergenic
1035830050 8:2686097-2686119 TTTAATGTATGCCATTTGATGGG + Intergenic
1036039895 8:5065002-5065024 TTTAAGAAATACATTTTGAAAGG + Intergenic
1036197385 8:6731675-6731697 TTAAAGGCATAGAATTTGATAGG + Intronic
1037066806 8:14590377-14590399 TGTAAGGTATACATTTTAATTGG + Intronic
1037158229 8:15732663-15732685 TATAAGTTATACAATTTAACGGG - Intronic
1037423545 8:18729595-18729617 TGTAAGGTATAGATTTTAACTGG + Intronic
1038530652 8:28315907-28315929 TTTAAAGCATACAATTTGGTGGG + Intergenic
1039464808 8:37777231-37777253 TTTAAGAAATACAATTTTCCAGG - Intronic
1039760590 8:40570334-40570356 TTTCAGTTATACAATTTGATGGG - Intronic
1041140642 8:54815264-54815286 TTTGATATATACAATTTGAGGGG - Intergenic
1041900981 8:62982339-62982361 TTCAATGTCTACAATTTGAATGG + Intronic
1042218565 8:66451303-66451325 ACTAAGGTATACAATGTGCCAGG + Intronic
1042268103 8:66929042-66929064 TTTAATCTATACAATTTGATGGG + Intergenic
1042831143 8:73029963-73029985 TTTAAAGTATACAATTTGATGGG - Intronic
1043045861 8:75324201-75324223 TTTAAAGTATAAAACTTTACCGG + Intergenic
1043489370 8:80732979-80733001 TTTAAGGATTATAATTTGGCTGG - Intronic
1043614753 8:82112046-82112068 CTTAATGTATACAATTTAAAAGG - Intergenic
1044553426 8:93536728-93536750 ATTAAGGTTTATAATTTGCCAGG - Intergenic
1044720099 8:95136959-95136981 TTTGTGGTTTACAGTTTGACAGG - Intronic
1051161306 9:14211513-14211535 TTTAAGGTAGACAATGGGAGTGG - Intronic
1051225507 9:14894918-14894940 TTTAAGGAATTAAACTTGACTGG + Intronic
1051871437 9:21742160-21742182 TGAAAGGTATTCAATTTAACAGG + Intergenic
1052627097 9:30989926-30989948 TTCAATGTAGAAAATTTGACAGG + Intergenic
1052679972 9:31678243-31678265 TTTAAAATGTACAATTTGATGGG - Intergenic
1052719468 9:32155858-32155880 TTTAAGATATCCATTCTGACTGG + Intergenic
1052912159 9:33892962-33892984 TTTAAAGTAAACAATTTGCAGGG + Intronic
1054929117 9:70618010-70618032 TTTAAGGTATACAACAAGATGGG - Intronic
1056209400 9:84351001-84351023 TATAAGGTAAAAAAGTTGACTGG - Intergenic
1056674365 9:88661452-88661474 TTTAAGGTGTACAATTCAATGGG - Intergenic
1056716129 9:89031265-89031287 TTTAAGGTGTACAATTCAATGGG + Intronic
1057991795 9:99777992-99778014 TTTAAAGGATACAATTTGATAGG - Intergenic
1058188388 9:101883480-101883502 TTATAGGTAAACAATTAGACAGG - Intergenic
1058414363 9:104770549-104770571 TTTAATCTATAAAATTTGTCAGG - Intronic
1058725262 9:107797228-107797250 TTTAATGTATAAGATTTGATGGG + Intergenic
1059861650 9:118470190-118470212 TTTAGGGTATACAGATTGAAAGG + Intergenic
1060041876 9:120307198-120307220 TTTAATGTATGCATTTTGAGGGG - Intergenic
1060059956 9:120450465-120450487 TTTAAGGTATACAATTCAGTGGG - Intronic
1061511167 9:131061751-131061773 TTTAACGCATACAATTCGGCTGG + Intronic
1062470231 9:136699907-136699929 TCTAAAGTGTACAATTTGGCCGG + Intergenic
1186553464 X:10531942-10531964 TTTAAGTTAGAGAATTTGAAAGG - Intronic
1186867064 X:13731119-13731141 TCCAAGGTATATAATTTGTCAGG - Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1187653358 X:21437780-21437802 TTTTAAGTATACAGTTTGATGGG + Intronic
1187683090 X:21787793-21787815 TTTAAGGAAAACAATCAGACTGG + Intergenic
1187892750 X:23952298-23952320 TTTGAAGAATATAATTTGACAGG - Intergenic
1187984446 X:24795369-24795391 TTGAGGGTATACAAATTCACAGG - Intronic
1188029057 X:25244041-25244063 TGTAAGGTAGACATTTTGAGAGG - Intergenic
1188071308 X:25721191-25721213 TTTAACATATACAATATGCCTGG - Intergenic
1188321522 X:28744135-28744157 TATAAGATATACATTTTGAAAGG - Intronic
1188527706 X:31104308-31104330 TTTAACGTGTACAATTTGAAAGG - Intronic
1189387467 X:40549179-40549201 TTTAAGGTGTACAACATGATGGG + Intergenic
1189558653 X:42170463-42170485 TTTAAGGTTTTCAATCTGAGTGG + Intergenic
1190535771 X:51426090-51426112 TTTAAGGAATATATTTTTACTGG - Intergenic
1192354460 X:70387569-70387591 TTTAAAGTTCACAATTTGGCCGG + Intronic
1193186303 X:78517160-78517182 TTTTATGTGTACAATTTGATGGG + Intergenic
1193275132 X:79577492-79577514 ATTAAAGTGTACAATTTGATGGG + Intergenic
1195511421 X:105720242-105720264 TTTAAAGTATGCAATTTGTAAGG + Intronic
1196014417 X:110922252-110922274 TTTAAGGTAGACAAGTTAGCTGG - Intergenic
1196207624 X:112958682-112958704 TTGAATGTTTACAATTTGCCAGG - Intergenic
1196333821 X:114505975-114505997 TTTAATGTATACAATTTGACAGG - Intergenic
1196711190 X:118764809-118764831 TATAAGATATAAAACTTGACTGG - Intronic
1197222655 X:123928655-123928677 TTTAAGGTATACAGTCTGAAAGG + Intergenic
1197505811 X:127303382-127303404 TTTAATGTATACTATTTGAAGGG - Intergenic
1197580476 X:128276936-128276958 TTTAATGTATACAATTTTTTAGG + Intergenic
1198762049 X:140042489-140042511 TTTAAAGTGTACAATCTGGCTGG + Intergenic
1201461339 Y:14228671-14228693 TTTACTGTATACAATTTGATGGG + Intergenic
1202580824 Y:26378795-26378817 TTAAAAGTATACAATTTCAAAGG + Intergenic