ID: 1146414525

View in Genome Browser
Species Human (GRCh38)
Location 17:32619938-32619960
Sequence GTCATTCTGGATATTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146414525 Original CRISPR GTCATTCTGGATATTGTGTT AGG Intronic
900543242 1:3214727-3214749 CTTATTCTGAATAGTGTGTTGGG + Intronic
902067975 1:13705096-13705118 GTCATTCTGTACATTGAGGTAGG - Exonic
902618043 1:17634624-17634646 GTGATTCTGGATATGGGGCTGGG + Intronic
908336977 1:63136259-63136281 GTGATTTTAGAAATTGTGTTGGG - Intergenic
910200994 1:84698473-84698495 GTCTTTCTGAATACTGTGCTAGG + Intergenic
910537150 1:88311284-88311306 ATCATTCTGGCTGCTGTGTTAGG - Intergenic
913312369 1:117513863-117513885 GTTATTCTTGATATTTAGTTTGG + Intronic
916997811 1:170320098-170320120 GTCTTTCTGGATATGGTTTAGGG + Intergenic
919158231 1:193795009-193795031 GTACTTCTGAATATTGTATTGGG + Intergenic
919529687 1:198701558-198701580 GTAATTCTGGATGTGATGTTGGG + Intronic
921129877 1:212210583-212210605 GTATTTCTGGAGTTTGTGTTGGG - Intergenic
921469042 1:215526442-215526464 GTGATTCTGTCTAGTGTGTTTGG + Intergenic
1063182065 10:3612084-3612106 AACATTCTGGATATTGGCTTTGG + Intergenic
1066244924 10:33573298-33573320 CTCATTCTGGATATCCTATTGGG - Intergenic
1066579045 10:36859932-36859954 GTCCTGCTGGGTGTTGTGTTTGG - Intergenic
1068389623 10:56377985-56378007 GACATTTTGGTTATTCTGTTAGG + Intergenic
1068891502 10:62152980-62153002 GGAAATGTGGATATTGTGTTTGG - Intergenic
1070441328 10:76446995-76447017 TAAATTCTGGAAATTGTGTTCGG + Intronic
1071902943 10:90140465-90140487 GCCATTTTGAATATTGTGTTAGG + Intergenic
1072207647 10:93218780-93218802 ATCATTCTGGATATTGGCATTGG + Intergenic
1075395079 10:122121199-122121221 TACATTCTGTATTTTGTGTTTGG + Intronic
1075448592 10:122531106-122531128 ATCATTCTGGATTTTCTGGTGGG + Intergenic
1077210915 11:1370563-1370585 GTCATTGTGCATTTTGGGTTCGG + Intergenic
1078023382 11:7673239-7673261 CTCATTCCGGATTGTGTGTTAGG - Intronic
1078874817 11:15382539-15382561 TTCATTTTGGAAACTGTGTTTGG + Intergenic
1079336611 11:19575688-19575710 GTCATCATCTATATTGTGTTGGG + Intronic
1080240476 11:30121812-30121834 GTGATTGTGGAGATTGTGCTTGG - Intergenic
1081188007 11:40068934-40068956 ATCATTCTGGACATTGGCTTTGG + Intergenic
1081778316 11:45692509-45692531 GTCATTCTGGAGATGGGTTTTGG - Intergenic
1084926375 11:72515857-72515879 ATCGTTCTGGACATTGGGTTTGG + Intergenic
1087474882 11:98622601-98622623 GTCATTTTGAATATTATGTTGGG + Intergenic
1090154361 11:124422077-124422099 GTCATCTTGCATATTGTTTTGGG - Intergenic
1091961216 12:4696149-4696171 GACATTTTAGATGTTGTGTTAGG + Intronic
1092681422 12:10986457-10986479 GTCATTCTGGTGATACTGTTGGG - Exonic
1092684807 12:11030932-11030954 GTCATTCTGGTGATGCTGTTGGG - Exonic
1092689488 12:11091826-11091848 GTCATTCTGGTGATGTTGTTGGG - Exonic
1092749915 12:11709175-11709197 GTCATTTTGGTTCTTATGTTGGG - Intronic
1094709722 12:32949304-32949326 GTCATTCTAGATTTTATTTTTGG + Intergenic
1095405539 12:41863131-41863153 TTCATTTTGGATTTTGTTTTTGG + Intergenic
1100597661 12:96085729-96085751 ATTATTCTGGGTATTGTGTCTGG - Intergenic
1100793777 12:98158536-98158558 GTCTATCTGGACATTGTGTGAGG + Intergenic
1101568931 12:105935397-105935419 CTACTTCTGGATATTGTGTTAGG + Intergenic
1105473005 13:20708369-20708391 GTCATTCAGTAAATGGTGTTGGG + Intronic
1107679492 13:42833629-42833651 ATCATTCTGGATTATCTGTTGGG + Intergenic
1109663185 13:65492543-65492565 GCCTTTCTGGATATTGTCTTTGG + Intergenic
1109925314 13:69129446-69129468 GTCATTAAGGAGATTCTGTTTGG - Intergenic
1110522170 13:76492497-76492519 GACGTTCTGAAAATTGTGTTAGG - Intergenic
1110768905 13:79313398-79313420 GTCATCCTGGAGTTTTTGTTTGG - Intronic
1111892309 13:94098896-94098918 GTCAGTATGTATATTGTGTGGGG + Intronic
1113699994 13:112377470-112377492 ATTATTGTGTATATTGTGTTCGG + Intronic
1116301188 14:43185505-43185527 GTGAATCTGGAGATTGTTTTGGG - Intergenic
1117806283 14:59494360-59494382 GTCATTTTCGCTATTGTGTTAGG - Intronic
1121806486 14:96829874-96829896 GTCATTTTGGATATTGCTATGGG + Intronic
1122370981 14:101228888-101228910 GTCATTCTGGTGAATGTGTGTGG + Intergenic
1123975436 15:25549156-25549178 GACATTTTGGTTATTATGTTAGG - Intergenic
1124353948 15:28981091-28981113 ATCATTCTGGATATTGGCCTTGG + Intronic
1125242740 15:37595056-37595078 GTCATTCTTGTTATTTTGCTAGG - Intergenic
1130610143 15:85353834-85353856 GTGATGCTGGATATTGTGCTGGG + Intergenic
1132631564 16:920056-920078 GCCATTGTGGATGTCGTGTTGGG - Intronic
1133456710 16:5948510-5948532 GTCATGCTGGATTTTGGGGTTGG + Intergenic
1135866391 16:26106284-26106306 GTCATCCTGGCTATTTGGTTAGG + Intronic
1137641782 16:50038326-50038348 CTCATTCTGAAAATGGTGTTTGG + Intergenic
1138311715 16:56029401-56029423 GACATTTTGGTTATTATGTTAGG - Intergenic
1138364993 16:56468034-56468056 GTTGTTCTGAATATTTTGTTTGG + Intronic
1140092769 16:71851304-71851326 GTCATGCTGCATTTTGTGGTTGG + Exonic
1140843040 16:78859567-78859589 GTCATTATGGATTTGGTTTTAGG + Intronic
1140873248 16:79126150-79126172 GTCATTCTGGATGATGTGATGGG + Intronic
1146414525 17:32619938-32619960 GTCATTCTGGATATTGTGTTAGG + Intronic
1153330120 18:3865102-3865124 GTAAGTCTGGATTTTGGGTTTGG + Intronic
1157405248 18:47417414-47417436 GTCATTCAGTTTATTGTGTGAGG - Intergenic
1157887898 18:51385946-51385968 GTTATGCTGGATATTGTATTGGG + Intergenic
1158132233 18:54165267-54165289 CTGATTTTGGATATTTTGTTAGG - Intronic
1159334040 18:67040268-67040290 ATCATTCTGGATATTATGCTAGG + Intergenic
1162777235 19:12987323-12987345 GTCATTCTGGATTTTATCTGTGG + Intergenic
1165220903 19:34316021-34316043 TTCATTCTGGATCTTGTCATAGG + Intronic
1165592288 19:36979456-36979478 GTTATTCCGAATCTTGTGTTTGG + Intronic
1167112108 19:47468659-47468681 GTCATTTTGGATGGGGTGTTTGG - Intronic
1167986955 19:53326802-53326824 GTGATTCTGTGTGTTGTGTTGGG + Intergenic
926318737 2:11732846-11732868 GTAATTCTGGTTATTGTTTTTGG - Intronic
927002018 2:18806255-18806277 TTCTTTGTGGTTATTGTGTTTGG - Intergenic
929635406 2:43515490-43515512 TTCATTCTGTATACTGTTTTGGG - Intronic
930369591 2:50486431-50486453 GTCATTTTGGATATCATTTTGGG + Intronic
930727690 2:54698105-54698127 GTCACTCTGCATATTTTGATTGG - Intergenic
932138894 2:69257521-69257543 TTCAATCTGTAGATTGTGTTGGG - Intergenic
932640470 2:73440795-73440817 GACATTTTGGATATTATGTTAGG + Intronic
933120799 2:78535034-78535056 GTTATTCTATATATTTTGTTTGG - Intergenic
934069865 2:88373975-88373997 GTCATCATGGTTAGTGTGTTAGG + Intergenic
936465149 2:112741490-112741512 TTCATTTTGGTGATTGTGTTTGG - Intronic
938574643 2:132592611-132592633 ATCACTCTGGATGCTGTGTTGGG + Intronic
939094575 2:137820110-137820132 GACATTGTGGATTTTGTATTGGG + Intergenic
939651805 2:144772246-144772268 GTTGTTTTGGATATTCTGTTAGG + Intergenic
940563218 2:155328383-155328405 ATCATTCTGGACATTGGCTTTGG + Intergenic
941050880 2:160732287-160732309 GTCATTCTGGACAATGCCTTTGG + Intergenic
942922203 2:181388874-181388896 ATCATTCTGTATATTGTGTTAGG + Intergenic
943845616 2:192642712-192642734 ATCATTCAGGGTCTTGTGTTTGG - Intergenic
947061064 2:226166430-226166452 GTCTTTCTGGACATTGTCTAAGG - Intergenic
1169050299 20:2571068-2571090 ATCATTCTGGATATTGGCCTTGG + Intronic
1172919628 20:38470367-38470389 ATCATTGTGTATAGTGTGTTTGG - Intergenic
1175627813 20:60503525-60503547 TTCATTCTGTAAATTCTGTTTGG + Intergenic
1176956709 21:15113255-15113277 TTCATTTTGGATATTCTGGTAGG - Intergenic
1177236738 21:18400647-18400669 ATCATTCTGGAAATTATGCTTGG + Intronic
1177350020 21:19926369-19926391 CTAATTTTGGACATTGTGTTTGG - Intergenic
1177400497 21:20597375-20597397 ATCATTCTGGATTTTTTGTCTGG - Intergenic
1178807644 21:35852511-35852533 GCCATTCTGGATATTTTTTACGG - Intronic
1181766392 22:25095214-25095236 GTGATTCTGGAGATTCTGTGGGG + Intronic
1182538526 22:31024508-31024530 GTCATGCTGTATATGTTGTTGGG + Intergenic
950598417 3:14007602-14007624 GTCACTCTGGACATTGGCTTTGG - Intronic
951938112 3:28045423-28045445 ATCATTCTGGACATTGTCCTTGG - Intergenic
952592158 3:34969399-34969421 GTCTCTCTGGATACTGCGTTTGG - Intergenic
953190403 3:40681191-40681213 GTCATTCTGGGTCTCATGTTTGG + Intergenic
953391593 3:42536851-42536873 GTTATTCTGGAGTTTTTGTTTGG + Exonic
955194257 3:56790479-56790501 GCCATCCTGGTGATTGTGTTGGG - Intronic
955466622 3:59243637-59243659 GTCACTCTGGCTACTATGTTGGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
958552543 3:95635799-95635821 GCTATTGTGGATATTGTATTTGG - Intergenic
959668573 3:108948792-108948814 GTCTTTCTGCATATTGTGCTGGG + Intronic
959754231 3:109877519-109877541 GCCATTCTGGATATTGGCCTTGG + Intergenic
959973674 3:112434596-112434618 ATCAATATGGACATTGTGTTGGG + Intergenic
960556841 3:119039448-119039470 GTCATTCTGGATTATCTGTGTGG - Intronic
961500692 3:127331748-127331770 GCCATTCTGTTTATTGTGTTTGG - Intergenic
962531149 3:136281711-136281733 GAAATTCTGAATATTATGTTTGG + Intronic
964096226 3:152934757-152934779 GTTATTCTAAATATTGTCTTTGG - Intergenic
964868949 3:161291982-161292004 GTCATTCTTGCACTTGTGTTAGG + Intergenic
964886692 3:161491642-161491664 CTCATTGTGGAAATTTTGTTTGG + Intergenic
965159475 3:165113448-165113470 ATCATTCTTGATAATGTGTATGG - Intergenic
965172852 3:165290603-165290625 ATCATTCTGGACATTGAGCTTGG - Intergenic
966089636 3:176117482-176117504 TCCATTCTGGATATTGGCTTTGG + Intergenic
966157498 3:176932926-176932948 GCCAATCTGGATAATGTGTCTGG - Intergenic
967280522 3:187818324-187818346 GCCATTCTGGATATTGCCTTTGG - Intergenic
971666383 4:29491535-29491557 GTCATTCTGTATATTTTATTGGG + Intergenic
971967792 4:33583650-33583672 GTTATTCTGGATATTTAGTCTGG + Intergenic
975773077 4:77750966-77750988 GACATTTTGGATATTATGTTAGG - Intronic
980802388 4:137769156-137769178 ATCACTCTGGCTGTTGTGTTGGG + Intergenic
981828119 4:148968176-148968198 GACATTTTGGCTATTATGTTAGG - Intergenic
984076683 4:175190329-175190351 GGCATTTTGTATATTCTGTTTGG + Intergenic
984138424 4:175971483-175971505 GTCATTCTGTTGAATGTGTTTGG - Intronic
984237662 4:177180364-177180386 GTCATTCTGCCTATTGTATATGG + Intergenic
984448712 4:179871565-179871587 TTCATTCTGGATATAGTTTGAGG - Intergenic
986252137 5:6069942-6069964 GTCACTATAGATTTTGTGTTTGG - Intergenic
986396304 5:7333941-7333963 GTGATTATGAATATTGTTTTTGG - Intergenic
986561264 5:9062575-9062597 GTCATTCTGGAGGCTGAGTTGGG - Intronic
986662270 5:10069747-10069769 GGCATTCTGGAGAGTGTGGTTGG - Intergenic
989690880 5:44142801-44142823 GTCATTCTGGATCTGGGGTCTGG + Intergenic
992094229 5:73345998-73346020 CTCATTATTGATATTCTGTTTGG - Intergenic
992571163 5:78059088-78059110 GTCATTCTGGATTTTCTGGGAGG + Intronic
992833711 5:80619958-80619980 GTAATTTTGCATATTGTCTTTGG - Intergenic
994410304 5:99399742-99399764 ATTATTTTGGAGATTGTGTTGGG + Intergenic
994483515 5:100365534-100365556 ATTATTTTGGAGATTGTGTTGGG - Intergenic
994542301 5:101114669-101114691 GTTGTTCTAGATACTGTGTTAGG + Intergenic
994633631 5:102317517-102317539 TTCTTTCTTGATATTCTGTTTGG + Intergenic
994913861 5:105947279-105947301 GTCATTCTGTGAATTTTGTTAGG + Intergenic
996207311 5:120756866-120756888 ACCATTCTGGATATTGTCCTTGG - Intergenic
996946191 5:129071584-129071606 GTCATTCTAGATATTCACTTAGG - Intergenic
998310511 5:141124569-141124591 GTTATACTGGATATTGAGTATGG + Exonic
999022635 5:148185163-148185185 TTAATTCTGTATATTGTTTTGGG - Intergenic
999114059 5:149146387-149146409 ACCATTCTGGATATTGGCTTTGG - Intronic
1003753688 6:9091859-9091881 GGCATTCTAGATAGTGTTTTAGG + Intergenic
1004121370 6:12825578-12825600 ATCATTCTGGTTTTTATGTTTGG + Intronic
1005362936 6:25049065-25049087 CTCATTCTGGATATCGACTTTGG + Intergenic
1007904585 6:45446423-45446445 TTCATTCTGAAAATAGTGTTAGG + Intronic
1012303181 6:97615789-97615811 TTCATTGTTGATTTTGTGTTTGG + Intergenic
1012893198 6:104920196-104920218 GACATTTGGGCTATTGTGTTAGG - Intergenic
1015381112 6:132570418-132570440 GTGATTCTGTACATAGTGTTTGG + Exonic
1016131003 6:140470260-140470282 GTCCTGCTGGAAATTGTTTTTGG + Intergenic
1019126224 6:169841869-169841891 GTCAAGCTGGAAACTGTGTTGGG - Intergenic
1021183711 7:17538104-17538126 ATCATTCTAGATATTGGCTTGGG + Intergenic
1021187413 7:17580849-17580871 GTCATTCTAGAGGGTGTGTTGGG - Intergenic
1021240329 7:18192593-18192615 GTCATTAAGGATATAGTATTTGG + Intronic
1022698743 7:32736488-32736510 ATCACTCTGGCTATTGTGTGAGG + Intergenic
1023570476 7:41566336-41566358 GTCATTCTGCATACTGTGGAAGG + Intergenic
1026398920 7:69989180-69989202 GTAATTCTTGGTATTGTGTATGG + Intronic
1026955751 7:74375681-74375703 GTCTTTCTGGATACTGTGATGGG + Intronic
1027308050 7:76922591-76922613 GTCAATATGGAGATTGTGGTAGG + Intergenic
1031751922 7:125585798-125585820 TTCTTTCTGTTTATTGTGTTTGG + Intergenic
1031812304 7:126386221-126386243 GTCCTTCTGAAAATAGTGTTGGG - Intergenic
1034321266 7:150184951-150184973 CTCCTTCTGTATATTGTGGTGGG - Intergenic
1034327845 7:150253630-150253652 GTACTTCTGGATATTATGATTGG - Intronic
1034765363 7:153715803-153715825 GTACTTCTGGATATTATGATTGG + Intergenic
1034771484 7:153782313-153782335 CTCCTTCTGTATATTGTGGTGGG + Intergenic
1038148128 8:24917140-24917162 ATCTTACTGGATATTGTGATTGG - Exonic
1039994232 8:42517736-42517758 CTCCTTCTGGATATTAAGTTGGG - Intronic
1043319713 8:78968835-78968857 ATCATTCTGGCTATTGTGTAAGG + Intergenic
1045782349 8:105881935-105881957 GTTATTTTGTATATTTTGTTCGG + Intergenic
1045868757 8:106901104-106901126 GTCATTTTGTATATGGTGATAGG + Intergenic
1046765559 8:118065606-118065628 GTAAAACTGCATATTGTGTTGGG + Intronic
1047305947 8:123653058-123653080 GTCACCATGGATATTGTGTAGGG + Intergenic
1051266836 9:15317504-15317526 GTCATGCTAGCTACTGTGTTGGG + Intergenic
1052468611 9:28863945-28863967 GTCATGCTAGTTATTGTATTAGG - Intergenic
1055591717 9:77822732-77822754 GACATTCAAGAAATTGTGTTAGG + Intronic
1056091003 9:83205907-83205929 GTCATTCTGAATATCATTTTGGG + Intergenic
1057697477 9:97335574-97335596 ATCATTCTGGATATTTGGGTTGG + Intronic
1057747851 9:97766099-97766121 TTGATTCTGGACATTGTGTGTGG - Intergenic
1061173954 9:128980627-128980649 ATCATTCTGGACAGTGTGTGTGG + Exonic
1187685421 X:21811125-21811147 CTCTTTCCGGAAATTGTGTTGGG - Intergenic
1189690230 X:43609988-43610010 GTCACTCTGTATCTTTTGTTTGG + Intergenic
1190500926 X:51077939-51077961 GGTATTCAGGACATTGTGTTTGG - Intergenic
1190859901 X:54334758-54334780 GTCTTTCTTGCTATTGTTTTAGG - Intronic
1191713108 X:64173961-64173983 GACATTTTGTATATTATGTTAGG + Intergenic
1192548769 X:72037054-72037076 GACATTTTGGATATTATGTTAGG + Intergenic
1193467933 X:81869469-81869491 GTCATGGGGGACATTGTGTTGGG - Intergenic
1194012485 X:88579908-88579930 ATCATTCTGAATATTGGCTTTGG + Intergenic
1194894952 X:99429392-99429414 GACATTTTGAATATTATGTTAGG - Intergenic
1195120678 X:101748326-101748348 ATTATTCTGGAAATGGTGTTGGG + Intergenic
1197303715 X:124814258-124814280 GACATAATGGATAATGTGTTTGG + Intronic
1198306259 X:135386545-135386567 GTCAGCCTGCATAATGTGTTAGG - Intergenic
1200803157 Y:7404889-7404911 GTCATTCTTAACATGGTGTTAGG - Intergenic