ID: 1146416238

View in Genome Browser
Species Human (GRCh38)
Location 17:32635684-32635706
Sequence CTCCGTCTCGGGTGGCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 2, 2: 5, 3: 32, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146416228_1146416238 10 Left 1146416228 17:32635651-32635673 CCACTGCACTCCAGTCTGGGTGA 0: 3347
1: 90407
2: 179275
3: 206110
4: 175571
Right 1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG 0: 1
1: 2
2: 5
3: 32
4: 190
1146416229_1146416238 0 Left 1146416229 17:32635661-32635683 CCAGTCTGGGTGACAGAGCAAGA 0: 1119
1: 30050
2: 78920
3: 153122
4: 161955
Right 1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG 0: 1
1: 2
2: 5
3: 32
4: 190
1146416225_1146416238 21 Left 1146416225 17:32635640-32635662 CCGAGATGGCGCCACTGCACTCC 0: 3752
1: 45341
2: 129347
3: 154251
4: 112760
Right 1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG 0: 1
1: 2
2: 5
3: 32
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146416238 Original CRISPR CTCCGTCTCGGGTGGCGGGG GGG Intronic
900395551 1:2451810-2451832 CTGCGTCTGGGCTGCCGGGGGGG + Intronic
900494934 1:2972031-2972053 CTCCTTCTCTGGCGGGGGGGGGG + Intergenic
901434268 1:9236582-9236604 CTCCGTCACCGGAGGCAGGGCGG - Intronic
901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG + Intergenic
902413769 1:16227065-16227087 CGCCGTCTCATGTGGAGGGGTGG - Intergenic
903906149 1:26688410-26688432 CTCTGTCTTGGGTGGGGGGTCGG - Intergenic
904683523 1:32245049-32245071 CTCCGTCTCGCCGGGCGCGGTGG - Intergenic
905170922 1:36109096-36109118 CTCTGTCTGGGGTGGGTGGGGGG - Intronic
905695584 1:39971067-39971089 CTCCGTTTTGGGTGGGAGGGAGG + Intergenic
907038440 1:51236666-51236688 GTCCGCCTCGGTTGGCGAGGTGG - Exonic
912620005 1:111145825-111145847 CCCTGTCTGGGGTGGAGGGGAGG - Intronic
919724442 1:200872916-200872938 CTCCGGCTTGGGTGGCAGGAAGG + Intergenic
919860712 1:201737981-201738003 CCCCGTTTCGGGTGGTGGTGAGG + Intronic
920331452 1:205211319-205211341 CTCCCTCACGGGCGGCGGCGGGG - Exonic
920348349 1:205321365-205321387 CTCCCTCTCGCGGCGCGGGGCGG - Intronic
920886959 1:209938418-209938440 CCGCGTCTCGGGAGGCGGGTGGG + Intronic
921177905 1:212609363-212609385 ATCCTTCCCGGGTGGGGGGGGGG + Intronic
922488702 1:225998120-225998142 CTCCGTCGGGGGTGGGGGAGGGG + Intronic
924559046 1:245142659-245142681 CTCCCTCACGGGTGGCTGTGAGG + Intergenic
1064334782 10:14429188-14429210 CTTCCTTTCGGGGGGCGGGGTGG + Intronic
1065970094 10:30799293-30799315 CTCTATCCCAGGTGGCGGGGGGG - Intergenic
1066016967 10:31257132-31257154 CTCCGTCTCGGTGGGAGGGAAGG - Intergenic
1067786838 10:49256458-49256480 CTCCAGATGGGGTGGCGGGGAGG - Intergenic
1067983510 10:51115305-51115327 CTCCATCTCGGGGCGGGGGGAGG + Intronic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1070745537 10:78931479-78931501 CTCCCTCTCGGGTGGGTGTGGGG + Intergenic
1072795720 10:98353021-98353043 CTCTTTCTGGGGTGGCTGGGAGG + Intergenic
1073297676 10:102450881-102450903 CGCGGCCTCGGGTGGCGCGGCGG + Exonic
1074977251 10:118591700-118591722 CTCCATCTCGGGGTGGGGGGTGG - Exonic
1075414966 10:122255808-122255830 CTCCGGGTTGGGGGGCGGGGGGG + Intergenic
1077439296 11:2560525-2560547 TTCCTTCTGGGGGGGCGGGGGGG + Intronic
1078001612 11:7501199-7501221 CTCGGGCTCAGGTGGAGGGGTGG + Intronic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083478117 11:62926830-62926852 CTCCGCCTCGGGGGGTGGTGGGG - Intergenic
1083670870 11:64299422-64299444 CTCCTTCTCCGGCGGCGGGGCGG - Exonic
1084962835 11:72726359-72726381 TTCTGTCTTGGGTGGCTGGGTGG - Intronic
1087921777 11:103875407-103875429 CTCCGTCTCAGCAGGGGGGGTGG - Intergenic
1089508190 11:118979074-118979096 CTCCTTCTGGGGTGGCTGAGAGG - Exonic
1090256378 11:125287491-125287513 CTCTGTCCCATGTGGCGGGGAGG + Intronic
1091506417 12:1073872-1073894 CTCCGTCTCGGGTGGGAGGGTGG - Intronic
1091616418 12:2053785-2053807 CTCCGTCTCGCGCGGCGGTTCGG - Intronic
1091973633 12:4808983-4809005 CTCCGTATTGTGTGGTGGGGCGG + Intronic
1092226706 12:6752808-6752830 CTCCTGCTCGCCTGGCGGGGAGG - Intronic
1096119009 12:49074594-49074616 CTCCAGCTTGGGTGGCGGAGTGG - Intergenic
1096436168 12:51592069-51592091 CTCTGCATCGGGTGGCGTGGGGG - Intronic
1102338434 12:112102691-112102713 CTCCATTGCGGGGGGCGGGGGGG - Intronic
1107704383 13:43085355-43085377 CTCCTTCTTGGGGGGTGGGGGGG + Intronic
1108075622 13:46676248-46676270 CTCCGTCTCGGTGGGGTGGGGGG + Intronic
1115979422 14:39033463-39033485 CTCCGTCCCTGGTTGCTGGGAGG + Intronic
1116455538 14:45116976-45116998 CTCTGTCTCGGTGGGGGGGGCGG - Intronic
1117029060 14:51651298-51651320 CGGCGTCTCGAGTGGCGGGCGGG + Intronic
1117322131 14:54634277-54634299 CTCCATCTCGGGGGGGTGGGGGG + Intronic
1119131486 14:72176863-72176885 CTCCTTCTGGGGTGGTGGGTTGG - Intronic
1119245188 14:73098647-73098669 CTCCGTCTTGGGTGGGGGTAGGG - Intronic
1121226026 14:92322777-92322799 CCCCGTGGTGGGTGGCGGGGTGG + Intronic
1122558134 14:102592448-102592470 GTCCGTCCGGGGCGGCGGGGCGG - Intergenic
1125892913 15:43279446-43279468 CTCCGTCTCGCCTGGTGGGGTGG + Intronic
1127820939 15:62655542-62655564 CTGCCTCTCCGGTGGCAGGGTGG - Intronic
1128232887 15:66047889-66047911 CTGGGCCTCGGGTGGAGGGGAGG + Intronic
1128379039 15:67098286-67098308 ATCTGTCTTGGGTGGTGGGGTGG - Intronic
1128386571 15:67153476-67153498 CTCCGTCTTGGGGGGCGGGCGGG + Intronic
1130009688 15:80141275-80141297 CTCCGTCTCGGGGGAGGGGGGGG - Intergenic
1131086503 15:89580021-89580043 CTCTGTCTCGGGAGGTGGGTGGG - Intronic
1131187489 15:90287307-90287329 CCCGGTGTCGGGGGGCGGGGAGG + Intronic
1131188413 15:90294323-90294345 CTCCATCTCCTGTGGGGGGGTGG - Intronic
1132640315 16:975179-975201 CTCCTTCTGGGGTGCAGGGGTGG - Intronic
1132688607 16:1172460-1172482 CTCCGTCTGGGGTGGTCGTGGGG + Intronic
1133069442 16:3235659-3235681 CGCCGTGGGGGGTGGCGGGGTGG - Intronic
1135013744 16:18906480-18906502 CTCCGTCTCGGGGTGGGGTGGGG + Intronic
1135320688 16:21494050-21494072 CTCCGTCTCGGGGTGGGGTGAGG + Intergenic
1135373523 16:21925540-21925562 CTCCGTCTCGGGGTGGGGTGAGG + Intergenic
1135438266 16:22445162-22445184 CTCCGTCTCGGGGTGGGGTGAGG - Intergenic
1136005246 16:27324872-27324894 CTCAGGCTGGGGTGGTGGGGAGG - Intronic
1138468555 16:57212619-57212641 CTCCGTCTCAGGGGGGTGGGGGG - Intronic
1138591529 16:58001738-58001760 CTTTGTCTGGGGTGGGGGGGAGG - Intronic
1139695235 16:68669601-68669623 CTCCTGGTGGGGTGGCGGGGGGG + Intronic
1141185182 16:81781876-81781898 CTCCGTCTCGGGGGCGGGCGGGG - Intronic
1141909833 16:87051112-87051134 CCGCGTCTCAGGTGGAGGGGAGG + Intergenic
1142840660 17:2626558-2626580 CTCCGCCTCGGGGGGGGGGGGGG - Intronic
1143178079 17:4967961-4967983 CTCTGTCTGCGGGGGCGGGGCGG - Intergenic
1143515404 17:7417231-7417253 CTCGGGCTCGGGAGGCAGGGTGG - Exonic
1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG + Intronic
1148106457 17:45121362-45121384 CTCCGTCAGGCCTGGCGGGGCGG + Exonic
1151580330 17:74973799-74973821 CTCCATCTCGGGGGGGGGGGGGG + Intergenic
1151606759 17:75142551-75142573 CTCCGTCAAGGGGGGAGGGGAGG + Intronic
1151818091 17:76481414-76481436 CTCTTTCTCGGGTGGCGGGATGG + Exonic
1153185122 18:2477923-2477945 CTCCATCTCGGGTGGGGTGGGGG - Intergenic
1153357712 18:4155951-4155973 CTCCGACTCGGGTGGGGCTGAGG + Intronic
1153896729 18:9569358-9569380 CTCTGTCTCGGGCGTGGGGGAGG - Intronic
1154260344 18:12826394-12826416 CTCCATCTCGGGGAGCAGGGCGG + Intronic
1154361522 18:13666609-13666631 CTCCTTGACGGGTGGCGGCGTGG + Exonic
1157261737 18:46181252-46181274 CTCCCTCTCGGGAGGTGGGGGGG + Intronic
1157951808 18:52046961-52046983 CTGAGTCTTTGGTGGCGGGGGGG - Intergenic
1158989079 18:62850378-62850400 CTCCATCTCGGGGGGGCGGGGGG + Intronic
1160025009 18:75209464-75209486 CTCGGGCAAGGGTGGCGGGGGGG + Intergenic
1160691088 19:460937-460959 CTCGGGCTCGGGGGGCGCGGGGG + Exonic
1161008602 19:1949030-1949052 CGCTGTCTCGGGTGGCAGAGCGG + Intronic
1161206096 19:3042119-3042141 CCCCTTCTCGGGTCCCGGGGAGG - Intronic
1162021328 19:7869785-7869807 CTCTGCGTCGGGGGGCGGGGAGG + Exonic
1162090053 19:8273681-8273703 CTCTGTCTCGGGCGGGGTGGCGG - Intronic
1162092287 19:8288544-8288566 CTCTGTCTCGGGCGGGGTGGCGG - Intronic
1162342876 19:10102464-10102486 CTCAGCCTGGGGTGGCGGGGTGG + Intronic
1162562320 19:11423823-11423845 GCCCGTCTGGGGTGGGGGGGGGG + Intronic
1162741363 19:12775564-12775586 CTGCGCCTAGGGGGGCGGGGCGG - Intronic
1165342934 19:35225305-35225327 CTCCGTGGGGGGTGGCGAGGAGG - Intronic
1165345773 19:35248304-35248326 CTCCGGACCGGGTGGAGGGGGGG - Intergenic
1165578487 19:36841840-36841862 CTCCATCTCGGGGTGGGGGGTGG + Intronic
1165748492 19:38245472-38245494 CTCCGTCTCGGGGCGGGGGGCGG - Intronic
1166014495 19:39970089-39970111 CTCCGTCTCGGGGCGGGGAGTGG + Intergenic
1166836320 19:45669940-45669962 CTCTGTCTCGGGGTGGGGGGGGG + Intronic
1167975986 19:53226262-53226284 CTCCGTCTCGGGGGGGGGTGGGG + Intergenic
1168100480 19:54138487-54138509 CTCCCTCGACGGTGGCGGGGAGG + Intronic
1168218479 19:54943592-54943614 CTCCGTCTGGGTTGGGGGGGCGG + Intronic
1168659413 19:58154697-58154719 CTCCGCCTGGGGCGGGGGGGGGG - Intronic
925084728 2:1099224-1099246 GTCCGTGTCGGGGGGTGGGGCGG + Intronic
925375699 2:3383403-3383425 CTCCGTCTCGGGCGGGGCGGGGG - Intronic
925972185 2:9113482-9113504 TTCCCTCTAGGGAGGCGGGGCGG - Intergenic
927514419 2:23663429-23663451 CGCCGTCACGTGTGCCGGGGAGG + Intronic
927900879 2:26817441-26817463 CTCCATCTCGGGGGGGGGGGGGG - Intergenic
929132653 2:38593712-38593734 CTCCGTCTCTGGTGTGGTGGAGG + Intronic
932422729 2:71611264-71611286 CTCCCTCTGGGGTGGTGGGTAGG - Exonic
938262903 2:129907773-129907795 CTCTGTCCGGGGAGGCGGGGTGG - Intergenic
939538571 2:143463532-143463554 CTCCATCTTGGGGGGTGGGGGGG + Intronic
941866896 2:170344457-170344479 CCCCGTCTCGGTTGGGGGGGTGG + Intronic
944540016 2:200745788-200745810 CTCAGCCCCGGGTGGCCGGGTGG + Intergenic
944780915 2:203015465-203015487 CTCCGTCTGGGGTGGGGTGGGGG - Intronic
944923395 2:204438348-204438370 CTCCGTCCCCGATGGCGGGTGGG + Intergenic
945057817 2:205883731-205883753 CTCTGTCTCGGGGGGTGGGGGGG - Intergenic
948058007 2:235023538-235023560 CTCCATCTCGGGCGGTGGGGTGG + Intronic
948186528 2:236025893-236025915 CTCCTTCTCGGGTGGGTGGATGG + Intronic
948636939 2:239344666-239344688 CCCCGTGCCGGGTGGCTGGGAGG + Intronic
948645385 2:239400894-239400916 CTCGGGCTCGGGCGGCGGCGGGG + Exonic
1169201613 20:3712910-3712932 CTCCCTCTCAGGTGTCAGGGAGG - Intergenic
1170404347 20:16020401-16020423 CCCTGTCTTGGGTGGAGGGGAGG - Intronic
1170676188 20:18483071-18483093 CTCCATCTCGGGGGGCGAGGGGG - Intronic
1172015552 20:31870595-31870617 CCCCGCCTCGGGTCGCGGCGGGG + Exonic
1172958507 20:38779509-38779531 CTCCGTCTTGGGAGGCGGGGGGG + Intergenic
1175521238 20:59604059-59604081 CTCCCTGCCGGGGGGCGGGGGGG - Intronic
1176068979 20:63216271-63216293 CCCAGTCTCGTGCGGCGGGGCGG + Intergenic
1176283385 20:64327999-64328021 CTGCGCCTGGGGTGGCGGCGGGG + Intergenic
1178550453 21:33533896-33533918 CCCCGTCTCAGGTTGGGGGGTGG + Intronic
1179838031 21:44050388-44050410 CTCCTTCTGGGGTGGGGGTGGGG + Intronic
1181149049 22:20869775-20869797 CTCCGTCTCGGTTGGGGGTGAGG - Intronic
1182098021 22:27638914-27638936 CCCCGCCTCTGGTGGTGGGGAGG + Intergenic
1183135287 22:35881255-35881277 CTCCGTCTCGGGTGGCAGGGAGG + Intronic
1184472192 22:44702292-44702314 CTCCGTCTCGGGTCCCGCGCCGG - Intronic
1185155526 22:49191438-49191460 CTCCGTCTCGGAAGGAGGAGAGG + Intergenic
1185284301 22:49993486-49993508 CTCCGTGTTGGGTGCTGGGGCGG + Intergenic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
951367587 3:21803087-21803109 CTGGGTGTCAGGTGGCGGGGAGG - Intronic
952242338 3:31544928-31544950 CTCTGTCTCAGGGAGCGGGGGGG + Intronic
952325269 3:32314843-32314865 CTCAGGGTTGGGTGGCGGGGGGG + Intronic
952388156 3:32857962-32857984 CTCAGTCTCGGGGTGAGGGGCGG + Intronic
952959614 3:38581108-38581130 CTCCGTCTCTGGGGGTGGCGGGG + Exonic
954236044 3:49258131-49258153 CTCCATCTCGGTTGGGGGTGGGG - Intergenic
954551930 3:51488956-51488978 CTCCGTCTCGGGTGGGGCAGGGG + Intronic
955340043 3:58118155-58118177 CACCCTCACGGGTGGCCGGGTGG - Intronic
961216643 3:125165186-125165208 CTCCTTCTGGGCTGGTGGGGTGG - Intronic
962812563 3:138972090-138972112 CGCAGTCTCGGCTGGCGGGCAGG + Intergenic
964107207 3:153052126-153052148 CTCTGCCTCGGCTGGCGGAGGGG - Intergenic
965211193 3:165791286-165791308 CTCCATCTTGGGGGGCGGGCGGG + Intronic
965592049 3:170370442-170370464 CTCCTGCTCGGGGGGGGGGGGGG - Intronic
965757635 3:172040962-172040984 CTTCGTCTGGGATGGCAGGGTGG - Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968213342 3:196867798-196867820 CCCCGGGTCGGGAGGCGGGGCGG + Intergenic
968398585 4:267294-267316 CTCCGTCTGGGGGGGGGGGGGGG + Intergenic
968453409 4:685697-685719 CTCCTTCTCGGGTGGCGGGGCGG + Intronic
969113366 4:4857069-4857091 CTCCGCCGCGGGGGGGGGGGGGG - Intergenic
969405232 4:6987212-6987234 CTCAGACTCGCGGGGCGGGGCGG - Intronic
969681188 4:8644349-8644371 CTCAGGCTGGAGTGGCGGGGAGG + Intergenic
972809236 4:42564086-42564108 TTCTGTCTGGGGTTGCGGGGCGG + Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
981087463 4:140698729-140698751 CTCCATCTCGGGGGTGGGGGGGG + Intronic
982194988 4:152902493-152902515 CCCTGTCTCGGGTCTCGGGGTGG + Intronic
983467429 4:168112289-168112311 CTCTGTCTGGGGTGGCGGGCTGG + Intronic
984155886 4:176195623-176195645 CGCGGTCTCGTGGGGCGGGGCGG + Exonic
984806671 4:183757819-183757841 CTCCGTCTTTGGGGGGGGGGGGG + Intergenic
984991535 4:185385892-185385914 CTCTGTCTCGGGGAGGGGGGGGG + Intronic
985729239 5:1537992-1538014 CGCGAACTCGGGTGGCGGGGCGG - Intergenic
985998205 5:3609302-3609324 TTCCCTCTGGGGTGGCCGGGAGG - Intergenic
987062284 5:14254188-14254210 CTCCGTCTCAGGCGGGGGGAGGG - Intronic
987518968 5:18953645-18953667 CTCTATCTCGGGGGGCGGGGGGG + Intergenic
988413077 5:30911921-30911943 CTCTGTCTCGGGTGGGTGGGGGG - Intergenic
1002295952 5:178231609-178231631 CCCAGTTTCTGGTGGCGGGGGGG + Intronic
1002494126 5:179600244-179600266 CTCGGGCCCGAGTGGCGGGGTGG - Intronic
1004214165 6:13686109-13686131 CTCTATTTCGGGGGGCGGGGGGG - Intronic
1005570875 6:27144453-27144475 CTCTGTCTGGGGGGGGGGGGGGG + Intergenic
1006975403 6:38096177-38096199 CTCTGTCTCGGGGGGTTGGGGGG - Intronic
1007012946 6:38435185-38435207 CTCTGTCTCGGGGGGTGGGGGGG + Intronic
1007702020 6:43771181-43771203 CTCCGGCTCGGGCTGTGGGGCGG - Exonic
1011654823 6:89542505-89542527 CTGTGTCTCGGGAAGCGGGGGGG - Intronic
1012875408 6:104720631-104720653 CTCCGTCTGGGGGGGGGGGGAGG - Intergenic
1015149462 6:130020646-130020668 CTCCGTCTCCCGTGGAAGGGTGG - Intronic
1015994943 6:138987948-138987970 CTCCGGCTCCGGCCGCGGGGAGG + Exonic
1017523978 6:155226657-155226679 CTGCATCTCGGGTGGGGGCGGGG + Intronic
1019271455 7:151320-151342 CTCCATCTTGGGTGGGGGTGGGG - Intergenic
1019722870 7:2583861-2583883 CACCGTGCTGGGTGGCGGGGCGG + Intronic
1019722912 7:2583971-2583993 CACCGTGCTGGGTGGCGGGGCGG + Intronic
1020096338 7:5371429-5371451 CTCTGTCTGGGGTGGTGGGCGGG - Intronic
1021558455 7:21945511-21945533 CTCAGTCTCGGGTGGCCGCCGGG - Intronic
1022319693 7:29277161-29277183 CTGCATCTGGGGTGGCGGGGAGG - Intronic
1022653713 7:32299149-32299171 TTCCGTCTCTGGTGGCTGGGGGG + Exonic
1025698143 7:63790458-63790480 CTCGTTCTCGGGAGGCGGGCCGG + Intergenic
1035004569 7:155645248-155645270 CACTGTCTCGGGGGGTGGGGGGG - Intronic
1038444959 8:27596816-27596838 CTCTGTCTCGGGGGGCGGGGGGG + Intergenic
1038786150 8:30618276-30618298 CTCTGTCTCGGGGGGCGGGGGGG + Intronic
1042307103 8:67343586-67343608 CTCCGGCCCTGGTGGCGGTGAGG + Exonic
1045068931 8:98479478-98479500 CTCCGTCTCGGGGGGGGGGGGGG + Intronic
1046247973 8:111591338-111591360 CTCCGTCTCGCGGTGGGGGGTGG + Intergenic
1050350899 9:4740806-4740828 CTCTGTCCCGGGCGGCGGGAGGG + Intronic
1053225013 9:36347112-36347134 CTCCATCTCGGGGGGGGGGGGGG + Intronic
1055554728 9:77462712-77462734 CTCCATCTCGGGGCGGGGGGTGG + Intronic
1056170294 9:83979517-83979539 CTCGGTGCCGGGAGGCGGGGAGG - Intronic
1057103951 9:92392606-92392628 CTCCATGTCGGGTTGGGGGGAGG + Intronic
1057866150 9:98683098-98683120 CTCCGTCTCGGGGGAGGTGGAGG - Intronic
1059340880 9:113597013-113597035 CTCCGTCACAGGGGGCAGGGAGG - Exonic
1061043199 9:128151311-128151333 CTGTGTGTTGGGTGGCGGGGGGG + Intronic
1061620311 9:131807512-131807534 CTCCCTCTGGGATGGAGGGGAGG + Intergenic
1062651268 9:137578924-137578946 CTCCTTCCGGGGTGCCGGGGCGG + Exonic
1062689511 9:137834104-137834126 CTCCGTCTGTGGTGGGGTGGGGG - Intronic
1203792505 EBV:159432-159454 CTTCGTCTCGGGTCCCTGGGAGG - Intergenic
1185656337 X:1688689-1688711 CTCTGTCTCGGGGGGAGGGGAGG + Intergenic
1189287220 X:39860328-39860350 CTCCATCTGGGATGGCTGGGAGG + Intergenic
1189757026 X:44282607-44282629 CTCCCTCTCGGGGCGGGGGGGGG + Intronic
1192237620 X:69305988-69306010 CTCCAGCGCGGGAGGCGGGGCGG + Intergenic
1197692875 X:129522517-129522539 CTCAGTTTGGGGGGGCGGGGGGG + Intronic
1198616658 X:138465220-138465242 CTCCATCTCGGGTTGGGGGCGGG - Intergenic
1200126837 X:153819208-153819230 CTCCGACGGGGTTGGCGGGGCGG - Intronic
1200142058 X:153907341-153907363 CTCTGTCTCGGGTGGGCAGGTGG - Intronic
1201319647 Y:12683756-12683778 CTCCATCTTGGGGGGCGAGGGGG + Intergenic