ID: 1146426122

View in Genome Browser
Species Human (GRCh38)
Location 17:32740952-32740974
Sequence CTGTGTAAATGAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 432}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146426122 Original CRISPR CTGTGTAAATGAAGGGAGGA AGG (reversed) Intronic
900562568 1:3314608-3314630 CTGTGTCAATGAAGGAAGGCTGG + Intronic
901116254 1:6847389-6847411 CTGTGCAAAGGAACGGAAGAAGG + Intronic
901561380 1:10074262-10074284 CTGAGTAACTGAAGGGAGATGGG - Intronic
901659755 1:10791347-10791369 CTGGGAAAAAGAAGGGAGGTGGG + Intronic
901922188 1:12545268-12545290 TTGAATGAATGAAGGGAGGAAGG - Intergenic
901942995 1:12678152-12678174 GAGTGTAAAGGATGGGAGGATGG + Intergenic
902239848 1:15081153-15081175 TTGAGTAAAAGAAGGCAGGAAGG - Intronic
903089820 1:20903204-20903226 ATGTGTAAATGAAAGAAGCAAGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903331812 1:22600470-22600492 CTGTGGAGACGAAGGAAGGAGGG - Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905264204 1:36739890-36739912 CAGTGTACTTGAAGGAAGGAAGG + Intergenic
905540668 1:38757925-38757947 CTGAATAAATGAAGGAAGGAAGG + Intergenic
905809206 1:40899571-40899593 CTGCCTCAAAGAAGGGAGGAAGG - Intergenic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
908378518 1:63572013-63572035 CTGGGCAAGTGAAGGGAGAAAGG + Intronic
908515147 1:64884640-64884662 CAGTGTGAGTGAAGGCAGGAGGG - Intronic
909730040 1:78878783-78878805 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
909850852 1:80461998-80462020 CTGTGAAAATGAAGAGAGTGAGG - Intergenic
910506874 1:87959407-87959429 GTGTGCAACTGAAGGGAGGAGGG + Intergenic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911368255 1:96966466-96966488 TTGTTTAAAAGAAGGCAGGAAGG + Intergenic
911417876 1:97598590-97598612 CTCTGAAAAAGAAGGGAGGGAGG + Intronic
911897253 1:103452327-103452349 CTCTCTCAATGAAGGGAAGAAGG + Intergenic
912208187 1:107531344-107531366 CTATGTTAATGAAGGGTGGGAGG + Intergenic
913997579 1:143664094-143664116 CTGTCTCAAGGAAGGAAGGAAGG - Intergenic
914504642 1:148278381-148278403 CTGTCTCAAGGAAGGAAGGAAGG + Intergenic
915088208 1:153403255-153403277 TTGTGTGTATGAAGGAAGGAAGG + Intergenic
915213457 1:154325924-154325946 CTGCGTACAGGATGGGAGGATGG + Intronic
915270850 1:154752387-154752409 CTGAGCAGATGAAGGAAGGAAGG + Intronic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915720714 1:157983383-157983405 CTATGTAAATGAAGCAAGGGAGG + Intergenic
916262274 1:162854246-162854268 ATCTGTAAATAAAGGAAGGAAGG + Intronic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920441630 1:205984800-205984822 CTTTGCAAATGAAGGGACAATGG - Intronic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
921411094 1:214836926-214836948 CTGAATGAATGAAGAGAGGAGGG - Intergenic
922725989 1:227923291-227923313 ATGTGAAGATGAAGGCAGGAGGG + Intronic
923127749 1:231047255-231047277 AGGAGGAAATGAAGGGAGGAAGG - Intergenic
923474294 1:234318320-234318342 TTCTGTAAATCAAGGGTGGAGGG - Intronic
1064004393 10:11688555-11688577 CTGTTGAAAGGAAGGTAGGAAGG - Intergenic
1064232773 10:13544107-13544129 CTGGGTTAATGAAAGAAGGAGGG + Intergenic
1064755917 10:18571791-18571813 CAGTGTAATGGAATGGAGGATGG - Intronic
1065055625 10:21839001-21839023 CTGGGTAAATAAAGAAAGGAAGG + Intronic
1065508975 10:26458381-26458403 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067084035 10:43228869-43228891 CTGAGTAAGTGAAAGAAGGAAGG + Intronic
1067250854 10:44586315-44586337 CTCTGCAGGTGAAGGGAGGATGG + Intergenic
1067695911 10:48535560-48535582 CTGTCTTACTGCAGGGAGGATGG + Intronic
1068489898 10:57710137-57710159 CTAAGTTAATGAAGGGAGAATGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068821702 10:61384365-61384387 CTGGTTAAATGAAGGGAGACAGG + Intergenic
1068895496 10:62195460-62195482 AACTGTAAAGGAAGGGAGGAAGG + Exonic
1069535656 10:69250728-69250750 CTGTAAAAATGAAGGCAGGCTGG - Intronic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1072111672 10:92327038-92327060 CTGTGTAAGTGTAGGGAGAGAGG - Intronic
1073512783 10:104052914-104052936 CTCAGTAAATGAAGGAAGGGGGG + Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074730348 10:116366270-116366292 CTGGGGTAATGAAGGGAGTATGG - Intronic
1075695971 10:124435550-124435572 ATGTGCAAAAGAAGAGAGGATGG + Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1078635373 11:13044758-13044780 CTGTTGAAAGGAAGGAAGGAAGG + Intergenic
1080156610 11:29118673-29118695 CTGTCAAAAAGAAGGAAGGAAGG + Intergenic
1082806068 11:57451572-57451594 CTGTGTAAAATTAGGCAGGAGGG + Intergenic
1084611916 11:70208712-70208734 CTGTGTAACAGAAGGCAGAAGGG - Intergenic
1084967716 11:72752995-72753017 CTGTGTATGTGCTGGGAGGATGG - Intronic
1085173685 11:74468715-74468737 CTGTCTAAAGGAAGGAAGGAAGG - Intergenic
1085198096 11:74684174-74684196 CTGTGTAAAGGAGGGGTTGAAGG + Intergenic
1085261638 11:75208857-75208879 CTGAATGAATGAAGGAAGGAAGG - Intergenic
1085454551 11:76658361-76658383 GGGTGGAAAGGAAGGGAGGAGGG + Exonic
1086037417 11:82433408-82433430 CTCTGTGAATGAAGGGACCAAGG - Intergenic
1086855926 11:91865774-91865796 CAGGGAAAGTGAAGGGAGGAGGG + Intergenic
1086894155 11:92293007-92293029 CTCTGCAAAGGAAGGAAGGAAGG + Intergenic
1087917785 11:103830887-103830909 CATTGAAAATGAATGGAGGAAGG + Intergenic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1089921327 11:122212343-122212365 CTCTGTAGATGCAGGGATGAGGG - Intergenic
1090009132 11:123030410-123030432 CTTTTTAAATGGGGGGAGGAAGG + Intergenic
1090061303 11:123466267-123466289 CTCTGTCAAGGAAGGAAGGAAGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1091004399 11:131939547-131939569 CTGTGCAGATGGAGGGAGTATGG + Intronic
1091546377 12:1503786-1503808 CAGTGAAGATGAAGGAAGGAGGG + Intergenic
1091591965 12:1847677-1847699 CTGTGTAAAAGCAGAGAGAATGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1091767969 12:3134241-3134263 CTGTGTGAATGAATGGGTGATGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1092996979 12:13959711-13959733 CTGATTGAATGAAGGGAGAAGGG + Intronic
1093650112 12:21633741-21633763 CTGTCTAGATGTAAGGAGGAGGG - Intergenic
1094586286 12:31780680-31780702 CTTTATAAAGGCAGGGAGGAAGG - Intergenic
1095444651 12:42271778-42271800 CTGTCTCAAAGAAGGAAGGAAGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096757514 12:53812562-53812584 CTCTGTCAAAGAAGGAAGGAAGG - Intergenic
1097736095 12:63182744-63182766 ATGTGCAAATGAATGGAGGAGGG + Intergenic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1099933702 12:89101427-89101449 CTTTTTAAATGGAGGAAGGAAGG + Intergenic
1100198518 12:92273987-92274009 TTGTGAAGATGAAGGCAGGAAGG - Intergenic
1100723167 12:97380224-97380246 CTGGGTATATGAAGGAAGGAAGG + Intergenic
1101517568 12:105451138-105451160 CTGTATACATGTAGAGAGGAAGG - Intergenic
1102995126 12:117343231-117343253 CTGTCAAAAAGAAGGAAGGAAGG + Intronic
1103031252 12:117615198-117615220 GTGTGTAACTGAAGAGAGAAGGG - Intronic
1103154406 12:118671813-118671835 CTGGGTAAATAAAGAAAGGAAGG - Intergenic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1104984192 12:132587410-132587432 CAGTGCAGCTGAAGGGAGGACGG + Intergenic
1105846374 13:24297692-24297714 CTGTGCAGATGAAAGGAGGCGGG + Exonic
1106066799 13:26360449-26360471 CTATGAAGATGAAGGGATGAGGG - Intronic
1106167260 13:27259170-27259192 CTGCTTTAATGAAGGGAAGAAGG - Intergenic
1106969780 13:35125591-35125613 ATGTGTAAAAGAAGGGACAAGGG - Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1108909610 13:55528745-55528767 CTTTCAAAATGAAGGGAGCAAGG - Intergenic
1110642068 13:77836567-77836589 ATATGTAGATGAAAGGAGGAGGG + Intergenic
1110897709 13:80776143-80776165 GTGTTTAAATGAATGGAGAATGG - Intergenic
1112152970 13:96784286-96784308 ATGTAGCAATGAAGGGAGGAAGG + Intronic
1112218207 13:97458414-97458436 GTGAATAAATGAAGGGAAGAAGG + Intronic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1112527015 13:100159590-100159612 CTTTGTAAATGAAAGTAAGAAGG + Intronic
1112553192 13:100442301-100442323 GTTTGTAAAGGAAGGAAGGAAGG - Intronic
1113130448 13:107030941-107030963 TTGAATAAATGAAGGAAGGAAGG - Intergenic
1113407631 13:110056396-110056418 CTGTTTCAAAGAAGGAAGGAAGG + Intergenic
1114744750 14:25135395-25135417 CTGAGTTCATGATGGGAGGATGG + Intergenic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1115529923 14:34317588-34317610 CTGAGGAACTGAAGGCAGGAAGG + Intronic
1115569426 14:34652891-34652913 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
1116370531 14:44125067-44125089 CTTTGAAAATGGAGGAAGGAGGG - Intergenic
1117155987 14:52942140-52942162 CTGAGTATATGAAAGTAGGAAGG - Intronic
1118054370 14:62063854-62063876 GTGTGTTAATAAAGGGATGAAGG + Intronic
1118235119 14:63996191-63996213 GAGTGGAAAGGAAGGGAGGAAGG - Intronic
1119378467 14:74213899-74213921 TGGTGTCCATGAAGGGAGGAGGG - Intergenic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120656277 14:87193850-87193872 CTGTGCACATGAAGGAAGGGAGG - Intergenic
1121504704 14:94467993-94468015 ATGGGTAGATGAAGGGTGGAGGG + Intronic
1122067853 14:99185946-99185968 ATCTGTGAAGGAAGGGAGGAAGG - Intronic
1125300714 15:38252015-38252037 TTTGGGAAATGAAGGGAGGAGGG + Intergenic
1125710408 15:41780875-41780897 CTGTTGAAAGGAAGGAAGGAAGG - Intronic
1125757766 15:42075880-42075902 CTGAGGAAAGGAAGGGAGGGAGG + Intronic
1127776645 15:62269366-62269388 GTGTCTAAATTAAGGGAGTAAGG + Intergenic
1129220333 15:74128591-74128613 CTGGGTAATGGAAGGGAGAATGG - Exonic
1129414361 15:75367005-75367027 CTGAGCCAGTGAAGGGAGGAAGG + Intronic
1129646020 15:77433863-77433885 TTGTGTACATGATGGAAGGAGGG + Intronic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130155558 15:81347164-81347186 CTGGGAAAATGAAGTGAGAAAGG + Intronic
1130731663 15:86499861-86499883 TTATATAAATGAAGGGAGCAGGG + Intronic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1134075653 16:11289638-11289660 CTAAGTAAATGGATGGAGGATGG - Intronic
1135634901 16:24067204-24067226 ATGTTTAAAAGAAGGGAGAAAGG - Intronic
1135691004 16:24537838-24537860 CTGTGTGAATGAAAGGGCGAGGG - Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1135851753 16:25970112-25970134 CTGTATAAATGATTGGAGAAGGG - Intronic
1136011648 16:27367362-27367384 CTGTGTAAAGGCAGGGCTGAGGG - Intergenic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1137469575 16:48742622-48742644 CTGTATAAAGAAAGGGAGGCAGG + Intergenic
1138070412 16:53987665-53987687 CAGTGTTTATGATGGGAGGATGG - Intronic
1138486734 16:57349965-57349987 CTGTGTAAAGGAAGGAAGATGGG - Intergenic
1138825682 16:60316488-60316510 CTCTGAGAAGGAAGGGAGGAAGG - Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1140783673 16:78319157-78319179 CTTTGAAAATGGAGGGAGGCGGG + Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143761384 17:9106516-9106538 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144038546 17:11388358-11388380 CTCTATAGGTGAAGGGAGGATGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1145846719 17:28044655-28044677 CTGTGGAAGGGAAGAGAGGAAGG - Intronic
1145911734 17:28547155-28547177 CTGAGTCAATGTTGGGAGGAAGG - Exonic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1146938453 17:36826923-36826945 CTGTGAAGAGGAGGGGAGGAAGG - Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148811078 17:50291740-50291762 CTGTGTAAAGGAATGGTGGTGGG - Intergenic
1149146137 17:53495649-53495671 CTAAGTAAATGAAGGGAACAGGG + Intergenic
1149930418 17:60748263-60748285 CTGCCTAAATGAAATGAGGAGGG + Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151716775 17:75835111-75835133 CTCTATGAATGAAGGAAGGAGGG - Intronic
1152232987 17:79124282-79124304 CTGTGTGATTGAAGGGAGCTGGG - Intronic
1153371331 18:4319859-4319881 ATGTGTATATGAAGGAATGAGGG - Intronic
1153980896 18:10309535-10309557 CTGTGTAATTGAGGGGAGGAGGG + Intergenic
1154172151 18:12060239-12060261 CTGGCTAAAGGAAGAGAGGAAGG + Intergenic
1155323689 18:24644588-24644610 GTGTACAAATGAAGGGAGGGTGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158021980 18:52853892-52853914 TTGTGTAAATGAGGAGAGGCAGG + Intronic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163090422 19:15015696-15015718 CTATATAAATGAATGAAGGAAGG + Intronic
1163090602 19:15017213-15017235 TTCTGTAAATGAATGAAGGAAGG + Intronic
1163363866 19:16865387-16865409 CTATGGAAAGGAAGGCAGGACGG - Intronic
1163468622 19:17484137-17484159 CTGAATGAATGAAGGAAGGAGGG + Intronic
1164818494 19:31225621-31225643 CTTTGTAACTGAAGGAAGGTGGG - Intergenic
1165654385 19:37520540-37520562 ATGGCTAAATGAAGGGAGGATGG + Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1167564169 19:50245974-50245996 CTATCTAAAAGAAGGAAGGAAGG - Intronic
1167564186 19:50246044-50246066 CTATCTAAAAGAAGGAAGGAGGG - Intronic
1167567561 19:50266552-50266574 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
925378293 2:3404738-3404760 TTGAGTAAATAAAGGGATGAGGG + Intronic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
926365509 2:12129615-12129637 CTGTGGAAATAAAGGGTTGAAGG - Intergenic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
927662025 2:25001320-25001342 CTGGTAAAATGAAGGAAGGAAGG - Intergenic
929066369 2:37979209-37979231 GTGTGAAAACGAAGGGTGGAGGG + Intronic
929423427 2:41818886-41818908 CTGTTGAAAGGAAGGAAGGAAGG + Intergenic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
930270002 2:49245053-49245075 CTGGGTAAATAACGAGAGGAAGG + Intergenic
930704977 2:54495966-54495988 TTAACTAAATGAAGGGAGGATGG + Intronic
931120179 2:59208115-59208137 ATGTGTCAATGAAAGAAGGAAGG + Intergenic
931645584 2:64418927-64418949 CTGTGCAGATGCTGGGAGGATGG - Intergenic
932582368 2:73000183-73000205 CTGTTTACATGAAGTGAAGAAGG - Intronic
933008653 2:77028401-77028423 GTGTGTTAATGAAGTGAGGAAGG - Intronic
935134010 2:100283286-100283308 CAGAATATATGAAGGGAGGATGG - Exonic
935591678 2:104851157-104851179 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
936563395 2:113561859-113561881 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
936624965 2:114138949-114138971 CTGCGTAGCTGAAGGAAGGAGGG - Intergenic
937989197 2:127653073-127653095 TTGTCTAAATGAAGGGCTGAGGG - Intronic
938940197 2:136163034-136163056 ATTTGTAAAGGAAGGAAGGAAGG - Intergenic
939258878 2:139781274-139781296 CTATCAAAAGGAAGGGAGGAAGG - Intergenic
940259198 2:151763141-151763163 CTGTGTAAATTCAGAGAGAAAGG - Intergenic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944997280 2:205308255-205308277 CTGTCTTAATAAAGGAAGGAAGG + Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
945058702 2:205889855-205889877 CTGTCTCAAGGAAGGAAGGAAGG + Intergenic
945453613 2:210022906-210022928 CTATGTAAATGTAGGAAAGATGG - Exonic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947683851 2:232062874-232062896 ATGTGAAAAGGAAGGAAGGAAGG - Intronic
948627877 2:239280287-239280309 CTGTGTTAAAGAAGGAAAGAAGG + Intronic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1169729518 20:8771884-8771906 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1169748238 20:8964676-8964698 CTGTGGCAAGGAAGGAAGGAAGG + Intronic
1170241904 20:14175368-14175390 CTGTGCTAATGAAGTGTGGAGGG + Intronic
1170270559 20:14522935-14522957 TTGTTTAAATGAATGAAGGAAGG + Intronic
1170391959 20:15884898-15884920 CTGTGTCCATGCATGGAGGAAGG + Intronic
1171231168 20:23486938-23486960 TTGTGTAAATGGTGGAAGGAAGG + Intergenic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1175826927 20:61941610-61941632 CTGGGGAAATGAAGTGGGGAGGG - Intergenic
1175835048 20:61988281-61988303 CTGTGCACCTGCAGGGAGGAGGG + Intronic
1175977360 20:62717731-62717753 ATGAGTGAATGAAGGAAGGAAGG - Intronic
1176342663 21:5713219-5713241 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1176474917 21:7145370-7145392 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1176502164 21:7611237-7611259 CCTTATAAAAGAAGGGAGGAGGG - Intergenic
1176536984 21:8111288-8111310 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1178252149 21:31013827-31013849 CTTTGTAAAAGAAGGAAGGAAGG + Intergenic
1178717222 21:34976609-34976631 CTGCGTCACAGAAGGGAGGACGG + Intronic
1178933590 21:36841444-36841466 CTGTGTAAAGGATAGGACGATGG + Intronic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179151847 21:38815929-38815951 CTGTTGAAAGGAAGGAAGGAAGG + Intronic
1180195930 21:46194391-46194413 CTGAGTGAATGTAGAGAGGAGGG - Intronic
1180941821 22:19664350-19664372 CTGAGTAAATGAAGGGGTCAGGG + Intergenic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1181884748 22:26011398-26011420 ATGAGAACATGAAGGGAGGAGGG + Intronic
1183840124 22:40492618-40492640 CTTTGTACAAGAAGGGAGGGAGG - Intronic
1184209205 22:43025351-43025373 CTGTGCAAATGAGTGGAGGGTGG - Intergenic
1184495756 22:44840381-44840403 CTGTGAAAAAGATGGGAGGGAGG - Intronic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1203241935 22_KI270733v1_random:27692-27714 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
949599458 3:5582252-5582274 CTGTGTATACCAAGGGAGAATGG - Intergenic
949916117 3:8965894-8965916 TTGTTAAAATGAATGGAGGAAGG - Intergenic
950024984 3:9813969-9813991 CTTGGTAAGTGAAGGCAGGAAGG + Intronic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
952346939 3:32496924-32496946 ATGTTTAGATGAAGGCAGGAGGG + Intronic
952464203 3:33563931-33563953 GTGTGTAAATGAATGGAGTGGGG - Intronic
953061603 3:39432834-39432856 ATAAGAAAATGAAGGGAGGAAGG - Intergenic
953491049 3:43351432-43351454 GTGTATGAAGGAAGGGAGGAAGG - Intronic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
955421594 3:58743704-58743726 CTGCCTAGAGGAAGGGAGGATGG + Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
956747976 3:72324417-72324439 CTGAGTGAATGAAGGGATGTTGG - Intergenic
956831876 3:73058814-73058836 CTTTTTAAAGGAAGGGAGAATGG + Intronic
957503222 3:81084760-81084782 GTGTGCAAAAGAAGGGAGAAGGG + Intergenic
958069089 3:88585974-88585996 TTATGTAAATGAATGGAGTAAGG + Intergenic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
958428163 3:94003926-94003948 CATTGTAAATGTAGGGACGATGG + Intronic
959886915 3:111513500-111513522 TTGTGTGAATGAAGTGTGGATGG - Intronic
959894641 3:111592506-111592528 CTGTCTGAATGAGGGAAGGATGG - Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961414517 3:126747752-126747774 CTCTGGAAATGAAGGGAAGGAGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962918780 3:139933327-139933349 TAGAGAAAATGAAGGGAGGAGGG + Intergenic
963078017 3:141366301-141366323 CTGTGTATATGAAGCAAGCAAGG + Intronic
963235500 3:142952035-142952057 CTGTGAAAAAGAAGGGGGGGGGG + Intronic
963469401 3:145719762-145719784 ATGAATAAATGAAGAGAGGAAGG + Intergenic
963486935 3:145946746-145946768 CCATGTAAATGAAGGAAGGAAGG - Intergenic
964898789 3:161631651-161631673 CTGTGTAATTGGATGGAGCAAGG - Intergenic
965787908 3:172355750-172355772 CAGTGTAAATGATGGTGGGATGG - Intronic
966671054 3:182526428-182526450 CTGATTTAAAGAAGGGAGGAAGG + Intergenic
967311698 3:188112209-188112231 CTGAGTAGATGAAAGGATGAAGG - Intergenic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968598379 4:1496986-1497008 ATGTGTAAATGATGGGTGGATGG + Intergenic
968598405 4:1497159-1497181 ATGTGTAAATGATGGGTGGATGG + Intergenic
968704236 4:2070583-2070605 CTGCGTAATTGAAGGGAAGAAGG + Intergenic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
970033224 4:11701575-11701597 ATGTGAAAATGAAGGGGGCAAGG - Intergenic
970444155 4:16110128-16110150 CTCTGTCAAGGAAGGAAGGAAGG + Intergenic
972240212 4:37182759-37182781 AGGAGTAAATGAAGGGAGGTAGG + Intergenic
973927752 4:55757044-55757066 TTGGCTAAATGAAAGGAGGAGGG - Intergenic
975459063 4:74629324-74629346 CTGTGTGCATGAAGGAATGAAGG - Intergenic
975559606 4:75696653-75696675 ATGTGTAAATGATGTGAGCATGG + Intronic
976253673 4:83078844-83078866 GAGTGTAAGTGATGGGAGGAAGG + Intergenic
978755687 4:112300521-112300543 CTATGTGAAAGAAGAGAGGACGG + Intronic
978878179 4:113667298-113667320 CTGAATAAATGAATGAAGGATGG + Intronic
978905706 4:114003135-114003157 CTGTGTAAATGAGAAGAGGTAGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979633156 4:122925891-122925913 ATGAATAAATGAAGGGTGGATGG + Intronic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
980693551 4:136327958-136327980 TTGTCAAAAAGAAGGGAGGATGG + Intergenic
981689723 4:147494410-147494432 TTGAGTAAAAGAAGGGATGAAGG + Intronic
982786686 4:159544424-159544446 CTGTGTAAATGACAGGAGACAGG - Intergenic
983973062 4:173897939-173897961 CTCTTTAAATGAAGGAAGGAAGG - Intergenic
984944934 4:184963245-184963267 CTTTGTAAATAAGGGCAGGAGGG + Intergenic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
989747608 5:44848841-44848863 CAGAGTAAATGAAGTTAGGATGG - Intergenic
990556403 5:56941017-56941039 CTGAGTAAATGATGGGAAGGTGG - Intronic
990683034 5:58267411-58267433 GTGAATAAATGAAGGAAGGAAGG + Intergenic
991208129 5:64073484-64073506 CATTGGACATGAAGGGAGGAAGG - Intergenic
992377557 5:76203327-76203349 ATGGGTAAATGAAGGGTGGGTGG + Intronic
992818856 5:80473362-80473384 ATGGGTAACTGAAGAGAGGAAGG - Intronic
993340547 5:86719968-86719990 CTGAGAAAATGTAGGAAGGAGGG + Intergenic
993523745 5:88938504-88938526 GTGTGTGAATGAATGAAGGAAGG + Intergenic
993654016 5:90556157-90556179 CTCAGTACATGAAGGAAGGAAGG - Intronic
993912581 5:93702612-93702634 CTGAATAAATGAAGGAAAGAAGG + Intronic
994677784 5:102846764-102846786 CTTTGTAAATCAAGAGAAGAAGG - Intronic
997734269 5:136201918-136201940 CAGTGTACATGAAGTGATGAGGG + Intergenic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
999179081 5:149656172-149656194 CTCAGTAATTGAAGGGAAGAGGG - Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999476966 5:151908982-151909004 GTTTGTAAATGAAGGGACTAAGG - Intronic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1000616305 5:163431793-163431815 CTGTTTAAATGATGTCAGGAAGG - Intergenic
1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG + Intergenic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1002364415 5:178698968-178698990 CTGTGGAAATGAAGAGATGGTGG - Intergenic
1003510534 6:6776061-6776083 CTGTGTCATTGATGGTAGGATGG - Intergenic
1003533645 6:6957462-6957484 ATGAGTGAATGATGGGAGGATGG - Intergenic
1003698748 6:8439079-8439101 CTGTGTCAAAGAAGGAAGAAAGG - Intergenic
1004107247 6:12677219-12677241 CTGTATCAAGGAAGGAAGGAAGG - Intergenic
1004880477 6:20002546-20002568 AAGTGTAACTGAAAGGAGGATGG + Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1005891499 6:30143884-30143906 CTGTGTAAATGAAAAAAAGAAGG - Intronic
1005939744 6:30552164-30552186 CTGAGTAAAAGAATGGATGACGG - Intronic
1007296366 6:40824645-40824667 CCGTCTACATGCAGGGAGGAAGG + Intergenic
1007331868 6:41117408-41117430 CTTTGTGACTTAAGGGAGGAAGG + Intergenic
1009006287 6:57792651-57792673 GAGTGGAAAAGAAGGGAGGATGG + Intergenic
1010032702 6:71288022-71288044 TTCTGCAAATGAAAGGAGGAGGG - Intergenic
1010624749 6:78123807-78123829 TTGTGTATATGAATGGAAGAAGG - Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1013854666 6:114557377-114557399 TAGGATAAATGAAGGGAGGAAGG - Intergenic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1015424441 6:133049393-133049415 CTGTCTCAAGGAAGGAAGGAAGG - Intergenic
1015848384 6:137546514-137546536 CTGTTAAAAAGAAGTGAGGACGG + Intergenic
1017329432 6:153178353-153178375 CTATGGAAATGAAGGGCTGATGG - Intergenic
1017404195 6:154099278-154099300 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1017502211 6:155036164-155036186 ATGAATAAAGGAAGGGAGGAGGG + Intronic
1017883845 6:158582326-158582348 CTGTCTTAGTGAAGTGAGGATGG - Intronic
1018038641 6:159902987-159903009 CTGTGGAAAAGAAGGGCTGAGGG - Intergenic
1019084480 6:169462428-169462450 CTGTCTCAAGGAAGGAAGGAAGG + Intronic
1019169297 6:170122843-170122865 CTTTGAAGATAAAGGGAGGAGGG + Intergenic
1019950756 7:4370423-4370445 CTGGGGAAATGAAGGTTGGAAGG + Intergenic
1020698375 7:11445703-11445725 CTGTGCACAGGAAGGGAGTAAGG - Intronic
1022478995 7:30730864-30730886 CTGTGCAAATGTTGGCAGGAGGG - Intronic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1023285639 7:38616101-38616123 CTGTGTAGATGATTGGGGGAAGG - Intronic
1023418612 7:39954542-39954564 AGGTGTAAATGAAGGGATGCTGG + Intronic
1023629866 7:42153531-42153553 CAGCCAAAATGAAGGGAGGATGG + Intronic
1023989789 7:45121882-45121904 ATGTGTACAGGAAGAGAGGAAGG - Intergenic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1026324013 7:69293273-69293295 CTCTGGAAAGGAAGGAAGGAAGG - Intergenic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1027716232 7:81674245-81674267 CTCTGAAAAGGAAGGAAGGAAGG + Intergenic
1027820934 7:83043675-83043697 CTGTGTAAATGCAGGAAGTCTGG - Intronic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1029889930 7:103917408-103917430 ATGTGTAAATGAATGCAGAAAGG - Intronic
1030035305 7:105403756-105403778 CTGTCGAAAGGAAGGGAGGGAGG - Intergenic
1030486080 7:110169624-110169646 CAGAGTAAATTAAGGGAAGAGGG - Intergenic
1030492970 7:110262317-110262339 CTGTGTTAATTAAGAGAGTATGG + Intergenic
1030535552 7:110762046-110762068 CTTTGGAAAGGAAGGGATGATGG - Intronic
1031303295 7:120090965-120090987 CTGTTTAAATGAAAGGAGGAAGG - Intergenic
1031328493 7:120433011-120433033 CTGTGTGATTGAAGCAAGGAGGG - Intronic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032312828 7:130803992-130804014 CAGTGTCAAGGAAGGAAGGAAGG + Intergenic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1032527463 7:132590224-132590246 CTGAGGAAATGAACTGAGGAAGG + Intronic
1033292458 7:140099098-140099120 CTTTGTAAATTAAGGGAGAGGGG - Intronic
1033410887 7:141116614-141116636 TAGTGTAGATGATGGGAGGATGG - Intronic
1034228425 7:149500427-149500449 CTGTGTAGATGTAGGGACTATGG + Intergenic
1035463329 7:159060027-159060049 GTGGGTAAGTGAAGTGAGGATGG - Intronic
1036083830 8:5590831-5590853 CTGTGTAAAGGAAGGGTTGGAGG - Intergenic
1036694317 8:10964734-10964756 CTGGGGAAATCAAGGGATGAGGG - Intronic
1037627836 8:20623607-20623629 CTGTGCAACTGAAGAGGGGAAGG - Intergenic
1037685684 8:21137680-21137702 GTGTGTAAATGATGGGATAAAGG + Intergenic
1037918900 8:22790204-22790226 ATGAGTGAATGAAGGAAGGAAGG - Intronic
1038597515 8:28902335-28902357 CTGTGAAAATGAAGGAGGGATGG - Intronic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1040568904 8:48591194-48591216 CTCTGTGAATGTAGGCAGGAAGG + Intergenic
1041041039 8:53846016-53846038 TTGTGTAACTGAAGGTAGGCTGG - Intergenic
1041933093 8:63308712-63308734 CTGAGTGAATGAAGCAAGGATGG - Intergenic
1042248056 8:66727688-66727710 CTGTGTCCTTGAATGGAGGAAGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044974224 8:97647522-97647544 CTGTCTAAAAAAAGGGGGGAAGG + Intronic
1045695188 8:104801245-104801267 ATGAGTAAATGAATGAAGGAAGG - Intronic
1046874888 8:119243206-119243228 ATGTTTAAAGGAAGGGGGGAGGG + Intronic
1047614256 8:126550211-126550233 CTGATTACATTAAGGGAGGAAGG - Intergenic
1047958956 8:129997032-129997054 CTTTGTGAAGGAAGGAAGGAAGG + Intronic
1048152501 8:131907842-131907864 GTGGGTAGAAGAAGGGAGGAAGG - Intronic
1048528970 8:135230060-135230082 CAGTGTCAGGGAAGGGAGGAAGG + Intergenic
1049889335 9:53866-53888 CTGTCTGAAGGAAGGAAGGAAGG + Intergenic
1052423692 9:28276238-28276260 CTGTGTACATGAAGAGAGGATGG - Intronic
1052462367 9:28782342-28782364 GTGAATGAATGAAGGGAGGAAGG - Intergenic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1053317850 9:37067733-37067755 CTTTGTATATGAAGTGAGGTAGG - Intergenic
1056209957 9:84356276-84356298 ATGGGTTAATGATGGGAGGAGGG - Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1056548483 9:87632790-87632812 CAGTGTATATGTAGGGATGAAGG + Intronic
1056604639 9:88076642-88076664 CAGGGGAAATGAAGGGAGGGTGG - Intergenic
1056819722 9:89830335-89830357 CTAAGTAAATGGATGGAGGATGG - Intergenic
1058000615 9:99861503-99861525 CTCTGTCAAGGAAGGAAGGAAGG + Intronic
1058353001 9:104048795-104048817 TTCTTTAAATGAAGGGAGGAAGG + Intergenic
1058622221 9:106895574-106895596 CTGTCCGAATGAAGGGAGGGAGG + Intronic
1059643662 9:116242365-116242387 AAGAATAAATGAAGGGAGGAAGG + Intronic
1059925420 9:119204671-119204693 CAGTTAAAAGGAAGGGAGGAAGG - Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061696129 9:132374936-132374958 CTGTAAAAAGGAAGGAAGGAAGG - Intergenic
1061772189 9:132934211-132934233 CTGTGTATAGGAAGGGTGTAGGG - Intronic
1203458252 Un_GL000220v1:10769-10791 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1186077662 X:5898248-5898270 AGGAGTAAAGGAAGGGAGGAAGG - Intronic
1186722357 X:12319087-12319109 ATGTGTCAATGAAGGGACAAGGG - Intronic
1186817446 X:13251912-13251934 CTGTGAAAATGAAGAGAGGAGGG - Intergenic
1187126782 X:16461883-16461905 AAATGTAAAGGAAGGGAGGAAGG + Intergenic
1188028763 X:25240219-25240241 CTGTGTAAATTCAGTGAGGGAGG - Intergenic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1191772490 X:64776284-64776306 CTGGGTAAATGAAGAAATGAAGG - Intergenic
1191780242 X:64856731-64856753 CAGTGTAACTGAAAGGGGGATGG - Intergenic
1192109550 X:68350535-68350557 CTGTCGGAAAGAAGGGAGGAAGG - Intronic
1192831129 X:74751846-74751868 CTCTGGAAAGGAAGGAAGGAAGG - Intronic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1197762238 X:130036119-130036141 CTGGGTGAATGAGGTGAGGAGGG - Intronic
1198006905 X:132504064-132504086 ATGAATAAATGAAGGAAGGAAGG + Intergenic
1198329893 X:135612581-135612603 CAGTGTCTATGAAGTGAGGATGG + Intergenic
1198457898 X:136835565-136835587 CTCTGTCAAGGAAGGGAGGGAGG + Intergenic
1198686404 X:139232222-139232244 CTGATTAAATGTAGTGAGGAAGG + Intergenic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1199411756 X:147532220-147532242 CAGTGTAGAGGAAGGGAGAATGG - Intergenic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic
1201540478 Y:15100491-15100513 CTGTGTAAGTGCAGGAAGAAAGG + Intergenic