ID: 1146430083

View in Genome Browser
Species Human (GRCh38)
Location 17:32784840-32784862
Sequence ATGGAGAACCGGAAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146430068_1146430083 15 Left 1146430068 17:32784802-32784824 CCCACAGAAAAGGAAGATACTGT 0: 1
1: 0
2: 0
3: 28
4: 313
Right 1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG 0: 1
1: 0
2: 3
3: 15
4: 178
1146430069_1146430083 14 Left 1146430069 17:32784803-32784825 CCACAGAAAAGGAAGATACTGTG 0: 1
1: 0
2: 0
3: 38
4: 312
Right 1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG 0: 1
1: 0
2: 3
3: 15
4: 178
1146430067_1146430083 16 Left 1146430067 17:32784801-32784823 CCCCACAGAAAAGGAAGATACTG 0: 1
1: 0
2: 4
3: 30
4: 362
Right 1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG 0: 1
1: 0
2: 3
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146430083 Original CRISPR ATGGAGAACCGGAAGGTGGT TGG Intronic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
901004006 1:6162952-6162974 AGGGAGAGCCGGAAGGAGGGAGG + Intronic
902641871 1:17772011-17772033 CAGGAGAACAGGGAGGTGGTGGG + Intronic
904238002 1:29126175-29126197 ATGGAGATCAGGAAGGTATTCGG - Intergenic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904685969 1:32260916-32260938 ATCAAGAACAGGCAGGTGGTCGG - Intronic
906105761 1:43291191-43291213 ATAGAGAAACAGGAGGTGGTGGG + Intergenic
912666011 1:111580328-111580350 ATGGAGCATGGGAAGGTGGGAGG + Intronic
912717758 1:111994030-111994052 ATAGAGAACCTGAAGGTAGCTGG + Intergenic
913179843 1:116311028-116311050 ATTGAGAACTGGATGGTGGATGG - Intergenic
917416435 1:174815131-174815153 GTGGGGAACGGGGAGGTGGTAGG - Intronic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
919093549 1:193002159-193002181 CTGGAGAACAGGAAAGTGGGAGG + Intergenic
920298206 1:204972709-204972731 TTGGAGGATGGGAAGGTGGTAGG + Intronic
920848591 1:209613247-209613269 AGGGAGACCTGGAAGCTGGTGGG - Exonic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922174677 1:223188172-223188194 ATGGAGAACAGGTTGGTGGTTGG + Intergenic
922344478 1:224684870-224684892 ATGGAGGATCGCATGGTGGTGGG + Intronic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1068907063 10:62338518-62338540 ATGGGGAACTGGAAAGGGGTGGG - Intergenic
1073917932 10:108427718-108427740 AAGGAGGACAGGAAGGGGGTGGG + Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077280582 11:1743316-1743338 ATGGACAAACGGAAGATGGATGG + Intronic
1080266476 11:30407065-30407087 AGGGAGAAACGGAAGCTGGGAGG - Intronic
1080760088 11:35240323-35240345 AAGGAGAAAGGGAAGGTTGTGGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1083429660 11:62607636-62607658 ATGGATAAGTGGAAGGTGATGGG - Intronic
1086404380 11:86487522-86487544 AGGAAGAACCAGAAGGTGGGAGG + Intronic
1090996069 11:131866981-131867003 ATGGAGAACAGGGAGGAGGTGGG + Intronic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091391578 12:129406-129428 AGGGAGAACAGGAAGCTGGAGGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092017325 12:5170115-5170137 ATGCAGAATCGGAAGGCGGAGGG + Intergenic
1093824492 12:23666969-23666991 AAGGAGAAATTGAAGGTGGTGGG - Intronic
1094596769 12:31873251-31873273 ATGGAGAGCCAGACGGTGGGTGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096793843 12:54061717-54061739 AGGAAGAACCAAAAGGTGGTGGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1102222970 12:111207046-111207068 ATGGATAAATGGATGGTGGTTGG + Intronic
1103764896 12:123272618-123272640 ATGAATAACCTGAAGGTTGTGGG + Intergenic
1107332130 13:39312290-39312312 CTGCAGAACAGGAAGGGGGTGGG + Intergenic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1113430476 13:110245922-110245944 ATGAAAAAGCGTAAGGTGGTGGG - Intronic
1114402505 14:22422806-22422828 ATGGAGCACCTGAGGGTGGCAGG - Intergenic
1115092794 14:29598563-29598585 AGGCAGGACCGGAAGGTGTTAGG + Intronic
1117294639 14:54367681-54367703 AAGGAGAGCCAGAAGATGGTGGG + Intergenic
1121190684 14:92026711-92026733 ATGAAGAACAGGAAGAAGGTGGG + Intronic
1121362511 14:93274485-93274507 ATGGAGGGATGGAAGGTGGTAGG + Intronic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1130547419 15:84867423-84867445 ATGGAGAACCAGAAGGGCTTAGG - Intronic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133338294 16:5020781-5020803 ATGGAGCTCCGGAGGGTGGGCGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137837251 16:51604605-51604627 ATGGACACCAGGAAGGTGCTTGG - Intergenic
1138320400 16:56106329-56106351 ATGGAGCACTGGAAGATGATTGG + Intergenic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140484164 16:75280876-75280898 ATGGAGAATTGGTTGGTGGTGGG - Intergenic
1141566113 16:84903200-84903222 GAGGAGACCCGGAAGGTGGGAGG - Intronic
1142419538 16:89961899-89961921 AGGGAGAGCAGGAAGGGGGTTGG + Intronic
1143017529 17:3898834-3898856 ATAGACAACCGGAAGTTGGGTGG - Intronic
1143045654 17:4076822-4076844 GTAAAGAACCGGAAGGGGGTTGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1152140483 17:78533616-78533638 CTGGAGAATCCCAAGGTGGTCGG + Intronic
1152245098 17:79181389-79181411 ATGGAAAACCGGGAGGGGCTGGG + Intronic
1152596462 17:81240019-81240041 GTGAAGACCCGGAAGGTGCTGGG - Intronic
1158443092 18:57494631-57494653 ATGGAGACCTGGAAGTTAGTAGG + Intergenic
1161106751 19:2447595-2447617 AAGGAGGACCGGAGGATGGTAGG + Intronic
1161432807 19:4243594-4243616 ATCGAGAACTGGAAGGAAGTGGG - Intergenic
1162768308 19:12933581-12933603 ATGGAGCACCAGGCGGTGGTGGG - Exonic
1163083813 19:14964270-14964292 AAGGAGATTCGGAGGGTGGTGGG - Intronic
1164595232 19:29527603-29527625 ATGGAGTTCTGGGAGGTGGTGGG - Intronic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1166068572 19:40374682-40374704 ATGGAGACCAGAAAGCTGGTGGG + Intronic
1166712290 19:44945144-44945166 ATGAAGCCCCGGAAGGTGCTCGG - Exonic
1167019446 19:46862515-46862537 ATGCAGAACAGGAAGGGGATGGG - Intergenic
1167430507 19:49451552-49451574 ATGGCGAACCCGAAGCTGCTGGG - Exonic
1168241155 19:55089508-55089530 ATGGAGAACAGGCTGGGGGTTGG - Intergenic
927644947 2:24871753-24871775 ATGGATAACAGGAAATTGGTGGG + Intronic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
931482522 2:62656190-62656212 ATGGGGAACAGGAAGGTTGGTGG - Intergenic
934136571 2:89001457-89001479 ATGGAGACCCAGAAGCTAGTAGG - Intergenic
934657374 2:96123283-96123305 CTGCAGAGCAGGAAGGTGGTAGG - Intergenic
934944478 2:98528722-98528744 ATGGAGGTCAGGAAGGTGGTAGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
941392171 2:164927652-164927674 ATGGGGGACGGGAAGTTGGTAGG - Intronic
941947798 2:171119357-171119379 AGAGAGAACAAGAAGGTGGTGGG - Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947155171 2:227155041-227155063 ATGGACCACCGGAATGTGGATGG + Intronic
947206779 2:227667986-227668008 ATGGAGAAAGGGCAGGTGGCAGG - Intergenic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
1169498108 20:6133912-6133934 AGGGAGCACCTGAAGGAGGTGGG - Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178384524 21:32138435-32138457 ATGGGGATCCAGAAGGGGGTTGG - Intergenic
1181084526 22:20433385-20433407 ATCTAGAACCGGAAGGTGGTGGG + Intronic
1182119024 22:27774965-27774987 ATGGGGAGCCGGTAGGTGGGAGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
952110145 3:30113345-30113367 ATGGAGAATGAGAAGGTGCTAGG - Intergenic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954852937 3:53618582-53618604 ATGGAAAACCAGAAGCGGGTGGG - Intronic
955881458 3:63550919-63550941 CTGGAAAACTGGAAGATGGTGGG - Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
961904175 3:130245382-130245404 ACTGAGAACCAGAAGGTGGTAGG + Intergenic
966282676 3:178251270-178251292 ATGGACATCCGGAAGGTGGAGGG + Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
970029374 4:11658188-11658210 AAGGAGGAACGGAAGGTGGAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
971481346 4:27117517-27117539 AAGGAGAATAGGAAGGTGGGTGG - Intergenic
971619966 4:28843878-28843900 ATAGAGAACAGAAAAGTGGTTGG - Intergenic
972547664 4:40095965-40095987 AGGGAGAACAGGTAGGAGGTTGG + Intronic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973047412 4:45551882-45551904 CTGGAGTACCGGAAGGCAGTTGG - Intergenic
974121118 4:57640316-57640338 ATGGGGAGCCGGAAGGTGAAGGG - Intergenic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
976839457 4:89414205-89414227 ATGCAGAACGGTAATGTGGTTGG + Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978603994 4:110459249-110459271 ATGGAGAAACGGAAGGAACTAGG + Intronic
978656997 4:111076081-111076103 TTGGAGTACCGGAAGGAGATGGG + Intergenic
978725271 4:111962235-111962257 ATTGAGAAGGGGAAGATGGTGGG - Intergenic
981599653 4:146471955-146471977 ATGGAGAACAGGAAATGGGTGGG - Intronic
981934189 4:150221289-150221311 AAGGAGAAGAGGATGGTGGTGGG - Intronic
983292758 4:165826755-165826777 ATGGAAAATAGGAAGGAGGTGGG - Intergenic
983511144 4:168610706-168610728 TTGGAGAGCCAGAAGGTGGTTGG - Intronic
983555065 4:169052600-169052622 AAGGAGAAAGGGAAGCTGGTTGG + Intergenic
984103306 4:175513924-175513946 AGGGAAAAAAGGAAGGTGGTGGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986587479 5:9334027-9334049 ATGGAGAATCGGAAGGTACTTGG - Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
994051494 5:95367173-95367195 CTGGAGACTAGGAAGGTGGTGGG - Intergenic
995467406 5:112465351-112465373 ATGGTGTACCTGAAAGTGGTGGG - Intergenic
995655716 5:114423909-114423931 ATGGAGAAAGGGAAGGTGCAGGG + Intronic
997258857 5:132449988-132450010 AGGGAGACCCGGAGGGAGGTAGG - Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999079436 5:148828958-148828980 AAGTAGAACTGGAAGGTGGGTGG - Intergenic
1000137567 5:158367658-158367680 AGGGAGCAACGGAAGGGGGTGGG - Intergenic
1001920336 5:175594806-175594828 ATGGAGACAGGGAAGGTTGTGGG - Intergenic
1003171564 6:3725218-3725240 AGGGAGGACGGGCAGGTGGTGGG - Intronic
1004905850 6:20236255-20236277 ATGCAGACTTGGAAGGTGGTGGG + Intergenic
1006517656 6:34553715-34553737 AGGAAGAAGCGGAAGGTGATGGG + Intronic
1006652441 6:35562820-35562842 AAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1007614468 6:43171969-43171991 ATGGAGATCGGTATGGTGGTCGG + Exonic
1007957815 6:45933229-45933251 ATTGGGAACCAGGAGGTGGTGGG + Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010735004 6:79434255-79434277 ATGGAAAACCAGAAGATGCTTGG + Intergenic
1013859523 6:114618502-114618524 ATGGAGGACAGGAAGATGGAGGG - Intergenic
1019155004 6:170032797-170032819 ATGGAGAACTGGAGGGTGCCAGG - Intergenic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1034443661 7:151101004-151101026 ATGGGGGACCTGAAGGTGGTTGG - Intronic
1034622073 7:152464033-152464055 AGGGAGACCCGGAAGGCGGTGGG + Intergenic
1035644063 8:1205054-1205076 ATGGGGAACCGGAATGTGGTTGG + Intergenic
1036438729 8:8760808-8760830 ATGGAAAATCCCAAGGTGGTGGG - Intergenic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1040876435 8:52157260-52157282 ATGGAGAATCTGAAGGTGAGAGG + Intronic
1042949293 8:74184575-74184597 ATTGAGAACTGAGAGGTGGTGGG + Intergenic
1044782016 8:95752856-95752878 ATGGATAAGGGGAAGGTGTTGGG - Intergenic
1046110208 8:109713785-109713807 ATGGAGACCTGGAAGGTTGCAGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1048054427 8:130849774-130849796 ATGGAGAACTGGATGGTCATTGG + Exonic
1048855714 8:138685196-138685218 ATGGAGAGCCGGTAAGTGGAAGG - Exonic
1053163198 9:35827914-35827936 GTGGAGAACCAGAAGATGGGAGG + Intronic
1055819321 9:80242814-80242836 ATGGAGAGAAGGAAGGAGGTAGG - Intergenic
1059730233 9:117049974-117049996 AAGGAGAAAGGAAAGGTGGTGGG + Intronic
1060611871 9:124973933-124973955 ATGGAGAACTAGATGGGGGTGGG - Intronic
1061209853 9:129184796-129184818 AGGGAGCACCAGACGGTGGTGGG - Intergenic
1061947392 9:133916386-133916408 TTGTAGAAAGGGAAGGTGGTGGG + Intronic
1062543672 9:137052524-137052546 AAGGAGAACAGGGAGGTGGTGGG + Intronic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1187069122 X:15870467-15870489 ATGGAGAACAAGAAGCTGGGAGG + Intergenic
1189123858 X:38425047-38425069 ATGGGGAACGGGAAGCTGGCTGG + Intronic
1189910230 X:45803787-45803809 AGGGAAAACCAGAAGTTGGTTGG - Intergenic
1193949487 X:87779939-87779961 TTGGTGTACCGGAAAGTGGTGGG + Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1196049753 X:111292506-111292528 AAGGAGAACCTGACGGTAGTGGG + Intergenic
1196049762 X:111292549-111292571 AAGGAGAACCTGATGGTAGTGGG + Intergenic
1196271419 X:113716342-113716364 ATGGGGAACCGGAAGGGGAATGG - Intergenic
1200230415 X:154441154-154441176 ATGGAGAACGGCAAGGTGGTGGG + Exonic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic