ID: 1146432289

View in Genome Browser
Species Human (GRCh38)
Location 17:32809238-32809260
Sequence TGTAGTCTTAGCAGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79416
Summary {0: 2, 1: 17, 2: 572, 3: 8470, 4: 70355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146432289 Original CRISPR TGTAGTCTTAGCAGCTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr