ID: 1146433215

View in Genome Browser
Species Human (GRCh38)
Location 17:32818682-32818704
Sequence TGCTATAGCGATCTTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146433209_1146433215 6 Left 1146433209 17:32818653-32818675 CCCTGAGATCAAATCCTGGTTCT 0: 1
1: 0
2: 9
3: 94
4: 416
Right 1146433215 17:32818682-32818704 TGCTATAGCGATCTTGGGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1146433210_1146433215 5 Left 1146433210 17:32818654-32818676 CCTGAGATCAAATCCTGGTTCTA 0: 1
1: 0
2: 29
3: 217
4: 1055
Right 1146433215 17:32818682-32818704 TGCTATAGCGATCTTGGGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1146433211_1146433215 -8 Left 1146433211 17:32818667-32818689 CCTGGTTCTACCACTTGCTATAG 0: 1
1: 0
2: 1
3: 27
4: 218
Right 1146433215 17:32818682-32818704 TGCTATAGCGATCTTGGGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146433215 Original CRISPR TGCTATAGCGATCTTGGGCA AGG Intronic
924902808 1:248419534-248419556 TGTTATAGAGACCTTGAGCAGGG + Intergenic
1074501614 10:114030072-114030094 GGCTATAGGGTCCTTGGGCAGGG - Intergenic
1075408517 10:122210746-122210768 TGCTATATGCATCTGGGGCAAGG - Exonic
1082807423 11:57459837-57459859 TGCGCTTGCGATCTTGGGGATGG - Intergenic
1083414834 11:62518685-62518707 TGGGATGCCGATCTTGGGCATGG + Exonic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1093927267 12:24921350-24921372 TGCTCTAGCGATCTGAGGAAAGG - Intronic
1095384458 12:41634233-41634255 TGCTTAAGAGATCTTGTGCATGG + Intergenic
1097753446 12:63383562-63383584 TGCTTTTGCTATCTTGGGTAAGG - Intergenic
1101492622 12:105223349-105223371 TGCTAAAGTGATCTTGCCCAGGG + Intronic
1103866747 12:124058500-124058522 TGCTAGACTGACCTTGGGCAGGG + Intronic
1105680347 13:22719516-22719538 TGCTATAGCCATCTTAGCAATGG - Intergenic
1112786501 13:102957338-102957360 TGCTACAGTGATCCTGGGCTGGG - Intergenic
1118188263 14:63557268-63557290 TGCTATTAGGATTTTGGGCAGGG + Intergenic
1126740169 15:51769313-51769335 TGCTAGAGCCATCCTGGACATGG - Intronic
1128298788 15:66549745-66549767 TGTTATAGTGGGCTTGGGCAAGG - Exonic
1140604044 16:76512935-76512957 TGTTATAGCGACCTTGGTGATGG + Intronic
1146433215 17:32818682-32818704 TGCTATAGCGATCTTGGGCAAGG + Intronic
938379343 2:130827875-130827897 TGCTCTAGCTCCCTTGGGCAGGG - Intergenic
945778639 2:214138953-214138975 TGCTAGAGTGATCTTGGGCTGGG + Intronic
1170491941 20:16886247-16886269 TTCTAGTGTGATCTTGGGCATGG + Intergenic
1174173422 20:48630686-48630708 TGCTGCAGGGAGCTTGGGCAGGG - Intronic
1175300756 20:57941154-57941176 TGCTATATGGATCTAGGGGAGGG + Intergenic
1177356614 21:20016791-20016813 TTCTACAGCGTTCTTGGCCAGGG + Intergenic
1177953117 21:27563681-27563703 TGCTATAGTAATTTTGGGTAAGG - Intergenic
1183925277 22:41201473-41201495 TGCTATGGAGCTCCTGGGCAGGG + Intergenic
949529288 3:4938400-4938422 TGCTGCAGCCATCTAGGGCAGGG + Intergenic
950586667 3:13897077-13897099 TGCTTTAGGGAACTTGGCCAAGG + Intergenic
984488211 4:180399489-180399511 TGGTCTAGCAATCTTCGGCAGGG + Intergenic
987195962 5:15526276-15526298 TGGCACAGTGATCTTGGGCATGG + Intronic
991507913 5:67343835-67343857 TGCTATACCTCTCTGGGGCATGG + Intergenic
999805652 5:155078710-155078732 TGCTAGAGCCATCTGGGACATGG - Intergenic
1002783473 6:384176-384198 TGCTGCAGGGATCTTGTGCAAGG - Intergenic
1005155466 6:22800891-22800913 TGCTATAGCTATATTGCCCATGG - Intergenic
1015965813 6:138693950-138693972 TGCTATTGAGATCGTGGTCATGG + Intergenic
1016688115 6:146904115-146904137 TGCTATAGCCTTCTTGAGGATGG + Intergenic
1020526298 7:9263133-9263155 TACTATAGAGAACATGGGCATGG + Intergenic
1024384477 7:48736170-48736192 TGCTAAAGCAATCTTGGAAAAGG - Intergenic
1024454313 7:49585419-49585441 TGCTAAAGCTGTCTTGGGAAAGG - Intergenic
1030203562 7:106929929-106929951 TGCTATATTGATGTTGGACATGG - Intergenic
1030789448 7:113706055-113706077 TGCTATATTGATCTTGCTCAGGG - Intergenic
1033493887 7:141874070-141874092 TGGTATAGAGCTCTTGTGCAGGG + Intergenic
1040463087 8:47668984-47669006 TGATATAGTGATTTAGGGCATGG - Intronic
1040476018 8:47778424-47778446 TGCTCTCGTGATCCTGGGCAAGG - Intronic
1041847937 8:62353137-62353159 TGCTATAGAGATCTGTGACAAGG + Intronic
1044265502 8:90176762-90176784 TGCTATAGCTATCTTAAGAACGG + Intergenic
1045063910 8:98428834-98428856 TACTTTAGCCAACTTGGGCAGGG + Exonic
1045135332 8:99210936-99210958 TGGTATGGCGTTCTTGGGCTAGG + Intronic
1188413084 X:29898278-29898300 TGCTATAGCTGCCGTGGGCATGG + Intronic