ID: 1146438794

View in Genome Browser
Species Human (GRCh38)
Location 17:32876449-32876471
Sequence GCGCTTCCCCGCGCCAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146438794_1146438805 28 Left 1146438794 17:32876449-32876471 CCTCACCTGGCGCGGGGAAGCGC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1146438805 17:32876500-32876522 CTAAACCCCGGACAGCGCCCAGG 0: 1
1: 0
2: 1
3: 2
4: 64
1146438794_1146438806 29 Left 1146438794 17:32876449-32876471 CCTCACCTGGCGCGGGGAAGCGC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1146438806 17:32876501-32876523 TAAACCCCGGACAGCGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 34
1146438794_1146438796 -9 Left 1146438794 17:32876449-32876471 CCTCACCTGGCGCGGGGAAGCGC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1146438796 17:32876463-32876485 GGGAAGCGCGCCCTCCCGCGCGG 0: 1
1: 0
2: 3
3: 6
4: 85
1146438794_1146438801 16 Left 1146438794 17:32876449-32876471 CCTCACCTGGCGCGGGGAAGCGC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1146438801 17:32876488-32876510 CACCCTCTGCACCTAAACCCCGG 0: 1
1: 1
2: 0
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146438794 Original CRISPR GCGCTTCCCCGCGCCAGGTG AGG (reversed) Intronic
900460981 1:2801998-2802020 GCGCTTCCTGGAGGCAGGTGGGG + Intergenic
900462537 1:2808585-2808607 GGGGTCCCCCGGGCCAGGTGCGG + Intergenic
900651866 1:3733749-3733771 ATGCTTCCCCGCGCCTGGGGGGG - Exonic
901776069 1:11561163-11561185 GGGCTTCCCTGTGCCAGCTGGGG - Intergenic
905287450 1:36890866-36890888 GCGCTTCCCCTCCCCAGGCTGGG + Intronic
909622379 1:77683064-77683086 GCGCACCCCCGCCCCACGTGGGG + Intronic
912576060 1:110674147-110674169 GCGACTTCCAGCGCCAGGTGTGG - Exonic
1065016994 10:21471166-21471188 AAGCTTCCCAGGGCCAGGTGAGG - Intergenic
1065054793 10:21833972-21833994 GGGGTTCCCCAGGCCAGGTGCGG + Intronic
1067091334 10:43267012-43267034 GCGCTCCCCGGCGCCGGCTGCGG - Intergenic
1073284502 10:102379539-102379561 GCGATGCCCGGCGCCAGGTACGG + Exonic
1074465737 10:113679804-113679826 GCACTACCCCGAGCCAGGGGCGG + Intronic
1074618322 10:115092971-115092993 GCCCTTCCCCCCGGCCGGTGCGG - Intergenic
1078088196 11:8247321-8247343 GCACATCCCTGTGCCAGGTGGGG - Intronic
1091461018 12:643323-643345 TCGCAGCCCCGCGCCGGGTGGGG + Intronic
1092204441 12:6606821-6606843 GCGCCTCCCTGCGCCCGGGGAGG + Intronic
1094807633 12:34107874-34107896 GCGCTTCCCCTGGCCAGCTCCGG - Intergenic
1101640129 12:106581629-106581651 GCGCTTCCCCGCCCCCGCCGCGG + Intronic
1102967858 12:117141807-117141829 GAGCTTCCATGAGCCAGGTGTGG - Intergenic
1113678298 13:112223246-112223268 CCACTTCCCCGTGCCAGGTGAGG + Intergenic
1113820445 13:113209267-113209289 ACGCATCCCCGAGCCAGGAGGGG + Intronic
1126150770 15:45522328-45522350 GCGCTTCCACGCGCCAGAGCCGG + Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1131648403 15:94371842-94371864 GCGTTTCCCTTAGCCAGGTGTGG - Intronic
1132221381 15:100108079-100108101 GCCCTTACCCTCCCCAGGTGGGG - Intronic
1133267656 16:4594552-4594574 GCGCACCCCAGCCCCAGGTGTGG + Intronic
1136478485 16:30527109-30527131 ACGCTTCCCGGCGCCAGCGGGGG + Intronic
1141490363 16:84368462-84368484 GCGCAGCCCCGCCCCAGGGGCGG + Intergenic
1142237379 16:88928592-88928614 GCGCTGTCACCCGCCAGGTGGGG + Intronic
1143539815 17:7562247-7562269 CGGCTTCCCCGCTCCCGGTGAGG + Exonic
1145041125 17:19579367-19579389 GCCCTTCCCCTTGCCAGGTAGGG + Intergenic
1146438794 17:32876449-32876471 GCGCTTCCCCGCGCCAGGTGAGG - Intronic
1147848930 17:43426186-43426208 GAGCTTCCCAGGGCCAGGCGGGG + Intergenic
1149566752 17:57645716-57645738 AAGCTTCCCAGGGCCAGGTGTGG - Intronic
1149867300 17:60157920-60157942 GCATGTCCCCGGGCCAGGTGGGG + Intronic
1151557135 17:74852226-74852248 GTGCTGCCCAGCGCCAGGTTGGG + Exonic
1151781869 17:76252034-76252056 GAGCTTCCCCGGGCCTGTTGAGG - Intergenic
1160878047 19:1306680-1306702 GTGCATGCCCGAGCCAGGTGTGG - Intergenic
1160964591 19:1741193-1741215 GTGCATGCCCGAGCCAGGTGTGG - Intergenic
1161403316 19:4078426-4078448 GAACTTCCCAGCGCCGGGTGGGG - Intergenic
1162019854 19:7863407-7863429 CCGGTCCCCCGCCCCAGGTGCGG + Exonic
1163793040 19:19319440-19319462 GCCTTTCCCTGGGCCAGGTGTGG + Intronic
1166255205 19:41599378-41599400 GCACTTCCCAGGGCCAGGGGTGG - Intronic
925988063 2:9231827-9231849 GCCCTTCCCTGCAGCAGGTGAGG + Intronic
926190126 2:10721853-10721875 GCGCTTCCCCGCGGCCGGGCTGG + Intronic
932594400 2:73085233-73085255 GTGCCTCCCTGCACCAGGTGTGG - Intronic
936089524 2:109491913-109491935 GCCATTCCCAGTGCCAGGTGGGG + Intronic
938912593 2:135898955-135898977 GCTCTGCCCCGAGCCAGGAGTGG + Intergenic
948494325 2:238337070-238337092 GGGCTGCCCCTGGCCAGGTGAGG + Intronic
1168887008 20:1266796-1266818 GCGCTGCACCGCGGCAGGTGGGG + Intronic
1171488004 20:25497766-25497788 GCGCTTGCCAGCGCCAGGTGGGG - Intronic
1172118266 20:32584036-32584058 GGGCCTCCCAGCGCCAGGGGAGG - Intronic
1180014430 21:45073429-45073451 CCGCTTCCCCCACCCAGGTGCGG + Intergenic
1180121277 21:45750110-45750132 GGGCCTCACCTCGCCAGGTGCGG + Intronic
1184101479 22:42343676-42343698 GCGCAGCGCCGCGCCGGGTGGGG + Intergenic
953595859 3:44313319-44313341 AAGCTCCCCCGGGCCAGGTGCGG + Intronic
954378278 3:50206023-50206045 ACCCTACCCAGCGCCAGGTGGGG - Intronic
955225039 3:57053326-57053348 GCTCCTCCCTGCCCCAGGTGTGG - Intronic
959723856 3:109522105-109522127 GGGATGCCCCGAGCCAGGTGTGG - Intergenic
961009060 3:123424015-123424037 GAGCATCCCGGTGCCAGGTGTGG + Intronic
964121924 3:153194102-153194124 GAGCTTCTCCGCGTCAGGTGTGG + Intergenic
968602308 4:1516000-1516022 GCGCAGCCCCGCTCCAGGGGAGG + Intergenic
969043775 4:4321574-4321596 GCGCTTCCCCCCCACAGCTGAGG - Exonic
972162551 4:36244397-36244419 GCGCTCCCCGCCTCCAGGTGCGG - Exonic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
977060848 4:92255260-92255282 GCGGCTCCCCTTGCCAGGTGTGG + Intergenic
980053748 4:128061385-128061407 CGGCTGCCCTGCGCCAGGTGAGG + Exonic
985472095 5:52996-53018 GCCCTTCCCTCCGCCAGGTGCGG - Intergenic
985488029 5:162826-162848 GGCCTTCCCCGGGGCAGGTGTGG + Exonic
985580577 5:693497-693519 GCGCGTCCCCGGGCCGGGTGGGG - Intergenic
1002710228 5:181190771-181190793 GCGAGTCCCCGTCCCAGGTGGGG - Intergenic
1003206632 6:4018733-4018755 GCTCTTCCCAGCGGCAGCTGGGG - Intergenic
1007782652 6:44263380-44263402 GGGTTTCCCCACGTCAGGTGGGG + Intronic
1010863094 6:80937728-80937750 GCACTTCCCTGTGGCAGGTGGGG - Intergenic
1027253053 7:76411107-76411129 GGGCTTCCCCAGGCCAGGGGAGG - Intronic
1029694228 7:102202451-102202473 CCACTTCCCAGCGCCAAGTGAGG - Intronic
1035205768 7:157292991-157293013 GCCCCTCCCAGCGCCCGGTGAGG + Intergenic
1037855329 8:22367392-22367414 CCGCCTCCGAGCGCCAGGTGAGG + Exonic
1044474115 8:92606150-92606172 CAGCTCCCCCGCGCCAGCTGGGG - Intergenic
1047615347 8:126558261-126558283 GCGCTTCCTCCCGCCAGCTGGGG + Exonic
1049645356 8:143733578-143733600 GCGCGGCCCCGGCCCAGGTGTGG + Intronic
1057470131 9:95349676-95349698 GCGCTTCCCCGCCCTAGGCCGGG - Intergenic
1057772921 9:97983695-97983717 GCTCTTCCCCGCGCCGGGGCCGG - Intronic
1060826827 9:126692409-126692431 GCACTTCCCCGCCCCAGGTTTGG - Intronic
1061048457 9:128180236-128180258 GAGCTTCCCCAGGTCAGGTGCGG + Intronic
1203768404 EBV:38364-38386 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768454 EBV:38489-38511 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768504 EBV:38614-38636 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768554 EBV:38739-38761 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768604 EBV:38864-38886 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768654 EBV:38989-39011 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768704 EBV:39114-39136 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768754 EBV:39239-39261 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768804 EBV:39364-39386 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768854 EBV:39489-39511 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768904 EBV:39614-39636 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1203768954 EBV:39739-39761 CCGCTGCCCCGCTCCGGGTGGGG + Intergenic
1192383276 X:70639091-70639113 GCGCTTCCCCCCGCCGAGTGAGG - Intronic
1197709385 X:129654820-129654842 GCGCTGCCCCGCGGCGGGAGAGG - Exonic
1198177800 X:134172872-134172894 GCGCATGCGCGCGCCGGGTGGGG - Intergenic
1198214640 X:134545204-134545226 GGGCTTCCCGGGGCCAGGAGTGG - Intergenic
1200063723 X:153495097-153495119 GCGCCTCCCCTCTCCAGGTAGGG + Exonic