ID: 1146438918

View in Genome Browser
Species Human (GRCh38)
Location 17:32876906-32876928
Sequence GGGCCTCCGGGGCCGCTCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146438902_1146438918 23 Left 1146438902 17:32876860-32876882 CCTGCTCCGCCATGGCGCCAGCG 0: 1
1: 0
2: 3
3: 8
4: 117
Right 1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG 0: 1
1: 0
2: 0
3: 30
4: 266
1146438908_1146438918 14 Left 1146438908 17:32876869-32876891 CCATGGCGCCAGCGCGGGGGCTC 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG 0: 1
1: 0
2: 0
3: 30
4: 266
1146438906_1146438918 17 Left 1146438906 17:32876866-32876888 CCGCCATGGCGCCAGCGCGGGGG 0: 1
1: 0
2: 1
3: 4
4: 107
Right 1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG 0: 1
1: 0
2: 0
3: 30
4: 266
1146438912_1146438918 6 Left 1146438912 17:32876877-32876899 CCAGCGCGGGGGCTCAGGTGGGC 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG 0: 1
1: 0
2: 0
3: 30
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146438918 Original CRISPR GGGCCTCCGGGGCCGCTCCG TGG Exonic
900129200 1:1080464-1080486 GGGCCTGGGGGGCTGCTCAGAGG + Intergenic
901045409 1:6393105-6393127 GGGCGTCCGGGGCGGCGGCGCGG + Intronic
901086782 1:6615373-6615395 GGGCCTTCGCCTCCGCTCCGTGG + Intronic
901646987 1:10722156-10722178 TGGCCTCCTGAGCCGCTCAGGGG - Intronic
902166100 1:14572732-14572754 GGGAGTGGGGGGCCGCTCCGCGG - Intergenic
902214348 1:14924774-14924796 GGGGCTCGGGGGCTGCACCGGGG + Intronic
902501479 1:16914265-16914287 TGGCCTCCGGTGCCGGGCCGCGG - Intronic
903925101 1:26826546-26826568 GGACCTGCGGGGCCCCGCCGCGG + Intergenic
905403838 1:37720368-37720390 GGGCCCCCGGGACCGATCAGAGG - Exonic
905921230 1:41720240-41720262 GGGCCTCCAGGGCTGCTCCCAGG + Intronic
906151614 1:43591084-43591106 GGCCCTCCGTGCCCGCTGCGCGG - Exonic
906293026 1:44632110-44632132 GGGACCCCGTGGCCGCTGCGCGG - Intronic
906876161 1:49541550-49541572 GGGCCTCAGCTGCCTCTCCGCGG + Intronic
909782266 1:79561669-79561691 GGGCCTCAGCCGCCTCTCCGTGG - Intergenic
912167332 1:107056810-107056832 AGTCCTCCGGGGTCGCTCCAGGG - Exonic
912381320 1:109249658-109249680 GGGCCGCCGGGGCCGGGCCGGGG + Intergenic
913548534 1:119894298-119894320 GGGCCTCCAGGACTGCTCAGAGG - Exonic
915355003 1:155250624-155250646 TGGCCTGCGGGGCCCCTTCGAGG - Exonic
918332407 1:183472544-183472566 GGTGCCGCGGGGCCGCTCCGAGG + Exonic
919464379 1:197912288-197912310 GGGCGTCCGGGCGCACTCCGAGG - Intronic
922586330 1:226737243-226737265 GGGGCTCCGGGGCTCCTCGGGGG + Exonic
922661171 1:227431740-227431762 GGGGCTCCGGGGCCTCGCTGGGG + Intergenic
1062874438 10:932508-932530 GGGCCTTCGGGGCAGGGCCGGGG - Intergenic
1063565888 10:7172030-7172052 GGCCCTCCGGGGCCGGGCCGAGG + Exonic
1064120640 10:12615185-12615207 GGGCCTCCTGGGCCACCCCTAGG + Intronic
1064121353 10:12622713-12622735 AAGCCTCCCGGGCCGCTCCAGGG - Intronic
1065019981 10:21495819-21495841 GCGCCTCCGCAGCCGCTGCGCGG - Exonic
1065186130 10:23172669-23172691 GGGCCTCAGGCGCGGCCCCGAGG - Intergenic
1073122599 10:101131720-101131742 GGGGCTCCGCGGCCGCGACGGGG + Exonic
1075645483 10:124093375-124093397 GGGGCTCCGGCGCCCCTCCGCGG - Intronic
1076096426 10:127737478-127737500 GGGGCTCCCGGCCCGCTCCTCGG + Exonic
1076528433 10:131127474-131127496 GGGCCACCTGGGCTTCTCCGAGG - Intronic
1076617991 10:131769544-131769566 GGGCCCTCTGGGCCGCCCCGAGG - Intergenic
1076692710 10:132231889-132231911 GGGCCCTCTGGGCGGCTCCGTGG - Intronic
1076782620 10:132732679-132732701 GGGCCTCAGGGTCCTCCCCGTGG - Intronic
1077205026 11:1337766-1337788 GGGCCTGGGGGGCGCCTCCGGGG + Intergenic
1077360984 11:2139978-2140000 GGGGCTCCGGCGCGGCACCGGGG - Intronic
1081831905 11:46121520-46121542 GGGCCGGCGGGGCCGCGCGGCGG - Intergenic
1082821224 11:57545973-57545995 GGGCCCCCGGGGCCGAGCAGGGG - Exonic
1083852594 11:65376919-65376941 GGGCCCCGGGGGCTGTTCCGAGG - Exonic
1083894680 11:65613992-65614014 GGGCCTCCGGCGCCTCACCATGG + Exonic
1084049541 11:66590835-66590857 GGGCTTCAGGGCCCGCTCCCAGG + Exonic
1084412135 11:69011285-69011307 TGGCCCCAGGGGCCGCTCCCAGG + Intronic
1084501959 11:69540291-69540313 GCTCCTCCTGGGCAGCTCCGTGG + Intergenic
1084546491 11:69817598-69817620 GCGCCTCCGGAGCCGCACGGTGG - Intronic
1084939247 11:72603531-72603553 AGGCCTCCCAGGCTGCTCCGAGG + Intronic
1084971523 11:72774759-72774781 GGGGCTCCGGGGCCTCTGCGGGG - Intronic
1089621971 11:119727655-119727677 GGGCCACCAGGGCCACCCCGGGG + Intronic
1091321521 11:134655607-134655629 GTGCCACCGGGGCTGCTCAGTGG + Intergenic
1091498236 12:991058-991080 GGGCCTCCGGGCGCCTTCCGGGG - Intronic
1092148743 12:6232675-6232697 GGGCTTCCTGGGCTGCTGCGGGG + Exonic
1092239538 12:6828527-6828549 GGGCCTGCGGGGGCGCCCCCGGG - Exonic
1094466002 12:30754654-30754676 GGGCGGCCGGCGCCGCTGCGAGG - Intronic
1100565539 12:95790590-95790612 GAGCCCGCAGGGCCGCTCCGCGG - Exonic
1102033471 12:109758066-109758088 GGGCCACCTTGGCCGCTCCAGGG + Intronic
1103363669 12:120368350-120368372 GGGGCGGCCGGGCCGCTCCGGGG - Intronic
1103415565 12:120739899-120739921 GGGCCTCTGGGCCAGCTCCATGG - Exonic
1104981377 12:132574395-132574417 GGCCCCCCGAGGCCGCCCCGGGG - Exonic
1105440991 13:20415312-20415334 GGGCCTCCAGGGCAGCCCCAGGG + Intronic
1106226282 13:27789641-27789663 GGGGCTCCCGGGCCCCTCCTGGG + Intergenic
1106708951 13:32311281-32311303 GGGCCTCCGGAGCGGCTCGGAGG + Exonic
1113768438 13:112894600-112894622 GGGCCGCGGGGGCCGATCCCAGG - Intronic
1113842211 13:113366541-113366563 GGGCCTCAGGGGCCACACCAGGG + Intergenic
1117545885 14:56794674-56794696 GGGCCGCCGGGTCCCCTCCAGGG - Intergenic
1117722129 14:58638239-58638261 GAGCCTCCGGCGCCGGCCCGAGG + Exonic
1119228002 14:72958735-72958757 GGGGCTCCCGGGGCGCGCCGGGG + Exonic
1119786821 14:77320614-77320636 GGGCCACAGCGGCCCCTCCGGGG + Exonic
1121101579 14:91253586-91253608 GCGCTCGCGGGGCCGCTCCGGGG + Intronic
1121557149 14:94847020-94847042 GGGCCACCGGGGCTGCTACACGG + Intergenic
1122230886 14:100305941-100305963 GGGGCGCCGGGGCAGCACCGTGG - Intronic
1122245571 14:100401153-100401175 GGGCCTCCGGGGCGCGTCGGCGG + Intronic
1122974100 14:105164026-105164048 GGCCCTCCTGGGCTGCTCCATGG - Intronic
1123041100 14:105490552-105490574 CTTCCTCCGGGGCTGCTCCGTGG + Intronic
1123939633 15:25210597-25210619 GGGCCTCCGGGGCACCACGGGGG + Intergenic
1124500439 15:30223290-30223312 CGGCCTCGGGGCCCGCGCCGGGG + Intergenic
1124639898 15:31391181-31391203 GGGCCTCTGGGGGTGCTCTGTGG + Intronic
1125677601 15:41511254-41511276 GGGCGGCCAGGGCTGCTCCGAGG - Exonic
1126738024 15:51751496-51751518 GGGACTGCGGGGCCGCGGCGAGG + Intronic
1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG + Intronic
1129299294 15:74616126-74616148 CGGCCTCTGGGGCCGCTCAAGGG + Intronic
1129450250 15:75647594-75647616 GAGCCTCCGGGGCTGGTCCCTGG - Intronic
1131174513 15:90201470-90201492 GGGCCCCCGGGGCGACTCGGGGG + Exonic
1132111464 15:99105087-99105109 GGGCCTCCGGGGCAGCGGCGAGG + Exonic
1132573938 16:656258-656280 GGGCCTCCAGGGCCACCCCGGGG - Intronic
1132816031 16:1826985-1827007 GGGCCGCCGCCGCCGCTCCCAGG - Exonic
1132912220 16:2319962-2319984 GGACCCCCGTGGCCGCTCAGTGG + Intronic
1133090667 16:3401412-3401434 CGGCCTCCAGGGCGGCCCCGCGG - Exonic
1134134112 16:11668489-11668511 GGGCCCGCGGGGCTGCTGCGGGG + Exonic
1134648318 16:15888593-15888615 CGGCCGCCAGGGCCGCACCGCGG + Exonic
1136556495 16:31010495-31010517 GGGGCGCCGCGGCCGCTGCGGGG + Exonic
1137655120 16:50153122-50153144 AGGCCTCCCGGGCTGCTGCGCGG + Intronic
1138505389 16:57475849-57475871 GTGCCTCCGGGGCTGCCCCAAGG - Exonic
1138514638 16:57529215-57529237 CGGGCTCAGGGGCGGCTCCGGGG + Exonic
1139390780 16:66605299-66605321 GGGACTCCCGGGCCGCAGCGGGG + Intronic
1139969450 16:70764799-70764821 GGGCCTCCGCGGCAGCCACGTGG - Intronic
1139974783 16:70800938-70800960 CGGCTGCCGGGGCCGCGCCGGGG + Exonic
1141173635 16:81705609-81705631 GTGCCTCCGGGGCAGCTGGGGGG + Intronic
1141945244 16:87305137-87305159 AAGCCTCCGGGGCCACTCCCCGG - Intronic
1142109393 16:88323223-88323245 AGGCCTCCGGGGCCCCTCCTCGG - Intergenic
1142120231 16:88383369-88383391 CGCCCTCGGGGGCCGCTCCCCGG + Intergenic
1142611135 17:1109635-1109657 GGGACTCCGGGGTGGCTCTGGGG - Intronic
1142799547 17:2336983-2337005 GGTCCTTCCCGGCCGCTCCGTGG - Exonic
1143116485 17:4584451-4584473 GGGCCTCGGGGGCGGAGCCGGGG - Intronic
1144490624 17:15704994-15705016 GGGCCGCCGGGGCCTCTCCAGGG - Intronic
1145208656 17:20997511-20997533 AGGCCTCAGGGGCCTCTCCAGGG - Intergenic
1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG + Exonic
1147161819 17:38572936-38572958 GCGCCGGCGGGGCCGCGCCGAGG - Intronic
1148452685 17:47790198-47790220 GGTCCTCGGGCTCCGCTCCGCGG + Intergenic
1148462533 17:47846847-47846869 GCGCCTCCGGAGCCGCCCTGCGG - Exonic
1148867235 17:50634991-50635013 GGGGCTCCGGGGTCACTGCGCGG + Intronic
1149610499 17:57955255-57955277 GGGCCGCAGGGGCCGGGCCGCGG + Exonic
1149623315 17:58062043-58062065 GGGCCTTGGGGGCCACTCAGAGG + Intergenic
1151555181 17:74843065-74843087 GGGCGACAGGGGCCGCTCGGAGG + Exonic
1152458989 17:80431603-80431625 GGGCCTGAGGGGCCGCACTGGGG - Intronic
1152689620 17:81712142-81712164 GGTGCTCCGGGGCTGCTGCGTGG - Intergenic
1152761443 17:82109298-82109320 GGGCCTACGAGGCGGCTGCGAGG + Intronic
1152960770 18:79222-79244 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1152960790 18:79292-79314 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1152960810 18:79362-79384 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1152960830 18:79432-79454 GAGGCTCAGGGGCAGCTCCGGGG - Intergenic
1152960841 18:79466-79488 GAGCCTCAGGGGCAGCTCTGGGG - Intergenic
1152960852 18:79500-79522 GAGCCTCAGGGGCAGCTCCGGGG - Intergenic
1152960863 18:79534-79556 GAGCCTCAGGGGCAGCTCCGGGG - Intergenic
1153480812 18:5544076-5544098 GGGCCCCCGCCGCAGCTCCGCGG - Exonic
1156245138 18:35290491-35290513 AGGCCCCCGGGGTCGCTCCCGGG + Intergenic
1158976557 18:62715915-62715937 GCGCCGCCGGGGCCGCTGCCGGG + Exonic
1160509674 18:79446366-79446388 GGGGCACCGGGGCAGCTCCAGGG - Intronic
1160719292 19:590334-590356 CGGCCTCGGGGCCCGCGCCGGGG + Exonic
1160763714 19:797991-798013 GCGCTTCCGGGGCTGCGCCGGGG - Intronic
1160775469 19:853220-853242 GGGGCTCAGGGGCGGCCCCGGGG - Intronic
1160921780 19:1524073-1524095 GCCGCTCCGGGGCCGCTCTGAGG - Intronic
1161337244 19:3721320-3721342 GGGCCTCCGGTTCCCCTCTGTGG + Intronic
1161800717 19:6415621-6415643 GGGCCGCAGGGGCCGGTGCGGGG + Exonic
1161925291 19:7294626-7294648 GGGCCTGTGGGGCGCCTCCGGGG - Intergenic
1162378243 19:10317486-10317508 GGGCCTCGGCGGCCACTACGCGG - Exonic
1162817822 19:13207226-13207248 GGGCCCCCGCGGCCTCTGCGCGG + Exonic
1162926569 19:13933231-13933253 GGGGCTCTGCGGCCGCTGCGGGG - Exonic
1163519045 19:17781167-17781189 GGGCCTCTGGGGCCTCCCCAGGG - Intronic
1163708606 19:18832348-18832370 GGGCCGCCGGGGCCGCCGGGGGG - Exonic
1165349178 19:35267281-35267303 GCGGCCCCGGGCCCGCTCCGTGG + Exonic
1165446833 19:35861211-35861233 GGGCCTGCGGGGCGGCGCCGCGG + Exonic
1166230918 19:41425526-41425548 GGGCCTCTGGGGCCGGCCCCTGG - Exonic
1167072306 19:47228169-47228191 GGGCCTCGGGGCCGGCTGCGGGG + Exonic
1167391895 19:49200672-49200694 TGGCCTCAGGAGCCCCTCCGTGG - Exonic
1167454467 19:49591289-49591311 GGGCGTCCCGGGCGGCCCCGGGG - Intergenic
1168301550 19:55407684-55407706 GGGCCGCCGGGGCCTCTCCAGGG - Exonic
1168686203 19:58350994-58351016 GGACCACAGGGGCCCCTCCGTGG - Intronic
925147166 2:1588934-1588956 GGTCCTCCTGGGCCTCTCTGTGG - Intergenic
926097511 2:10091634-10091656 GGGCCTTAGCGGCCGCGCCGCGG + Intergenic
926326134 2:11786182-11786204 GGACCTCCGGGGACTCTCCTGGG - Intronic
927591412 2:24360727-24360749 GGGGCTTCGGGGCCTCCCCGAGG - Intergenic
929460948 2:42101655-42101677 GGGCCGTCGGGGGCGTTCCGGGG - Intergenic
929488003 2:42372002-42372024 GGGCTTCAGGGCCTGCTCCGCGG - Intronic
938555099 2:132416833-132416855 GCGCCTCCTGGGCCTCTCCTAGG + Exonic
938701453 2:133883968-133883990 GTCCCTCCGGGGCTGCTCGGGGG - Intergenic
941666205 2:168246694-168246716 GGGCCTCCGCGGCTTCTACGTGG + Intronic
948061416 2:235045454-235045476 GGGCCTCCCTGTCCGCTCCAGGG + Intronic
948166197 2:235864512-235864534 GGGGCTCCGGGGCCGCGCAGTGG - Intronic
948464001 2:238143550-238143572 GGGCCTCCAGAGCCGCTGCGGGG - Intronic
948601133 2:239108049-239108071 GGGCCTCCGGGGCAAATGCGAGG - Exonic
948619614 2:239226090-239226112 GGGCCTGCGGAGCCCCTCAGTGG - Intronic
948642646 2:239385360-239385382 GGGCCTCCGGGTCACCTCCGAGG + Intronic
948699368 2:239750661-239750683 GGGCATCCAGGGCCTCTCCAGGG - Intergenic
948846866 2:240687495-240687517 GTGCCTCCTGGGCCCCACCGTGG + Intergenic
1171465543 20:25325316-25325338 GGGCCTCCCAGGCCTCTCAGGGG - Intronic
1175424639 20:58855660-58855682 GGGGCCCCGGGGCCCCTCCCCGG - Intronic
1175746191 20:61459098-61459120 GGGCCACTGGGGCCTCTCCAGGG - Intronic
1175790119 20:61735592-61735614 GCGCCTTCGGGGCCACTGCGGGG + Intronic
1176131658 20:63498983-63499005 GGACCCCCGGGGCCGGTCCTGGG - Intronic
1176180374 20:63746958-63746980 GGGCCTCCTGGGGGGCTGCGCGG + Exonic
1176368062 21:6045550-6045572 GGGCCTCATGGGCAGCTCTGAGG - Intergenic
1178314834 21:31559120-31559142 CGGCCTCGGGGGCCGGGCCGCGG + Intronic
1178680255 21:34668570-34668592 GGGCCTCTGGAACCTCTCCGGGG + Intergenic
1178840676 21:36135503-36135525 GGGCCCCCTGGAGCGCTCCGAGG + Intronic
1179675062 21:42975178-42975200 GGGCCGGCGGGGCTGCTCGGAGG + Intronic
1179755457 21:43492992-43493014 GGGCCTCATGGGCAGCTCTGAGG + Intergenic
1180005420 21:45018559-45018581 GGGCCGCCGAGCCCGCTGCGAGG + Intergenic
1180038853 21:45265455-45265477 GATCCTCCAGGGCCGCTCCCCGG - Exonic
1180057498 21:45366556-45366578 GGGCCTCCGGGTCAGCGGCGGGG + Intergenic
1180110314 21:45644259-45644281 CAGCCGCCGCGGCCGCTCCGGGG - Intronic
1180614894 22:17120665-17120687 GGGCCCCGGGAGCCGCTCGGCGG - Exonic
1181007989 22:20023322-20023344 AGGCCGCAGGGGCCGCTGCGAGG + Intronic
1181381569 22:22508693-22508715 GCGCCTCCGGGGCTGGTGCGTGG - Exonic
1181934475 22:26429186-26429208 GGGCCTGCGGGGCGGGGCCGGGG - Intergenic
1182091286 22:27596653-27596675 GGGCCTGGGAGGCCGCTTCGTGG - Intergenic
1182098123 22:27639425-27639447 GGGCCTCCCCAGCAGCTCCGTGG - Intergenic
1182237131 22:28884231-28884253 CGGCCTCCGGGGCGCATCCGCGG + Intronic
1182439775 22:30356515-30356537 GTGCCGACGGGGCTGCTCCGCGG + Intronic
1183362692 22:37390869-37390891 GGGCCTCCAGGGCCTCCCCCTGG - Intronic
1183702237 22:39457290-39457312 GGGCCCCCGCCGCCGCCCCGGGG + Intergenic
1183753615 22:39738166-39738188 GGGCCTCAGGGGATGCTGCGTGG - Intergenic
1184223936 22:43118397-43118419 GGGCCTCCAGGGCTGCTGAGAGG - Intronic
1184258849 22:43302988-43303010 GGAGCTCCGGGGCCCCTCCTTGG - Intronic
1184478940 22:44736188-44736210 GGGCCTCGCTGGCCGCTGCGTGG - Intronic
952316734 3:32238596-32238618 GGGCGTCCGCGGCGCCTCCGCGG + Intergenic
953675418 3:44997857-44997879 GGGCCTCTGGGGCCTCACCCAGG - Intronic
955218819 3:57007011-57007033 GGGCCACAGGGGGCGCTCCTGGG + Intronic
956080237 3:65549415-65549437 CGAACTCCGGGGCCGCTCCGGGG - Intronic
958977211 3:100682144-100682166 TGGACTCCGGGGGCGCTCCCTGG - Intronic
959056947 3:101576509-101576531 TGGCCGCCGTGGCCGCACCGTGG - Intronic
962575374 3:136751641-136751663 GGGCCTGGGGGGTCGCTCGGCGG - Intronic
963253204 3:143120502-143120524 GGTGATCCGGGGCCGCTCCCGGG + Exonic
966835149 3:184044028-184044050 GGGCCTCCTGAGCCGCACCTAGG - Intergenic
967087619 3:186108961-186108983 GCGCCGCCGGGGCCGCTGCAAGG - Exonic
968092753 3:195908922-195908944 GGGGCGCCGGGGCCGCTCCCAGG + Intronic
968508886 4:986856-986878 GGGCCTCAGGGGCTGCTCTGAGG - Intronic
968603348 4:1520655-1520677 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603367 4:1520696-1520718 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603406 4:1520778-1520800 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603465 4:1520901-1520923 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603484 4:1520942-1520964 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603522 4:1521024-1521046 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603541 4:1521065-1521087 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603560 4:1521106-1521128 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603579 4:1521147-1521169 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968603598 4:1521188-1521210 GCCCCTCCGAGGCCGCCCCGGGG + Intergenic
968657679 4:1785672-1785694 GGGCCTCAGGGGCCTCCCAGGGG - Intergenic
968756534 4:2418862-2418884 TGGCGTCCCGGGCCGCGCCGCGG + Intergenic
968902387 4:3437802-3437824 GGGCCTCTGGGGCCACTGCTGGG + Intronic
969116077 4:4871627-4871649 GGGACTCCGGGGCCGCAGCTGGG - Intergenic
969379158 4:6782932-6782954 GGGGCTCCGGGGCCAGCCCGAGG + Intronic
969392557 4:6901242-6901264 GGGCCTCCAAGGCCCCTCTGTGG - Intergenic
970332940 4:15003487-15003509 GCGCCTCCGTGGCGGCGCCGCGG - Exonic
970615741 4:17766950-17766972 GGGCCTCAGGTGCCTCCCCGCGG - Intronic
970967864 4:21948820-21948842 GGGGCGCCGGGGGCGCTGCGCGG + Intergenic
976431351 4:84966323-84966345 GGGGCTCCCGGGCCCCGCCGCGG - Exonic
977955347 4:103019627-103019649 TGGGCTCCTGGGCCGCTCCCGGG - Exonic
985111980 4:186555481-186555503 GGGCGTCCGGGGGCGCGGCGTGG - Exonic
985629851 5:1008743-1008765 CGGCCGCCGGGGGCGCTGCGGGG + Intergenic
985801546 5:2007912-2007934 AGGCTTCCTGGGCCCCTCCGTGG - Intergenic
987088059 5:14487762-14487784 CGGCCTCGGGGGCCGCGCCAGGG - Exonic
995988417 5:118208091-118208113 GGGCCTCCGCTGCCTCTCCGTGG - Intergenic
996811303 5:127518240-127518262 GAGCCTCCTGGGCCTCTCCAGGG - Intronic
997265019 5:132490404-132490426 GGGCCTCCGCGCGGGCTCCGGGG - Intronic
1001014296 5:168126648-168126670 GGGCCTCGGGGCCTGCTCCAGGG + Intronic
1001415338 5:171541614-171541636 GGGCCTCCTGGGATGCTCCCTGG + Intergenic
1001930983 5:175672829-175672851 GGGCCTCCTGGACCCCTCCAAGG - Intronic
1002419626 5:179138858-179138880 CGGCCTCTGCGGCCGCTCCTGGG - Intronic
1002522539 5:179799688-179799710 GGGACTCGGGGGCCGCTGCAGGG - Intronic
1003290939 6:4777118-4777140 GTGCCTCCGTTGCCGCTCGGCGG + Intronic
1004217601 6:13716969-13716991 GGGCCTCAGCTGCCTCTCCGCGG + Intergenic
1006313280 6:33276424-33276446 TGGCCGCCGTGGCCGCACCGTGG + Exonic
1006396159 6:33788865-33788887 GGCCCGCCGCGGCCTCTCCGCGG - Exonic
1006970393 6:38038085-38038107 GGGCCTCCAGGGCTGCTGTGCGG + Intronic
1016590089 6:145735104-145735126 GGGCCTGCGGGGCCTGCCCGAGG + Intronic
1017103384 6:150866705-150866727 GGGACTCCGTGGGCGCTGCGCGG - Intronic
1018013717 6:159693710-159693732 GGGCCCCCGTGGCCGTTCCTAGG + Intronic
1018916886 6:168138594-168138616 GGAGCTCCGGGGCAGCTCCTGGG - Intergenic
1018942665 6:168319663-168319685 GGGCCTCCGGCGCCGCTCGTGGG - Exonic
1019344624 7:523099-523121 GCGTGTCCGGGGCCCCTCCGGGG + Intergenic
1020078296 7:5273178-5273200 GGGCCTCAGGGGTGGCTCCTTGG - Intergenic
1020727289 7:11831885-11831907 GGCGCTGCGGGGCCGCGCCGGGG - Exonic
1021451121 7:20784813-20784835 GGGCCTTCGGCGCCGCTGGGGGG - Exonic
1022721095 7:32942649-32942671 CGGCCTCCAGGGCCCCTCCGTGG + Intergenic
1022721220 7:32943108-32943130 GGGACTTCGGGGCCCCTCCCGGG - Intergenic
1024055703 7:45658821-45658843 GTGCTTCCAGGGCCCCTCCGGGG + Intronic
1024541634 7:50479718-50479740 GGACCTCCAGGGCAGCTCTGAGG + Intronic
1025051812 7:55739183-55739205 CAGCCTCGGGGGCTGCTCCGTGG + Intergenic
1025200600 7:56959012-56959034 GGGCCTCAGGGGTGGCTCCTTGG + Intergenic
1025671344 7:63617920-63617942 GGGCCTCAGGGGTGGCTCCTTGG - Intergenic
1025712851 7:63927771-63927793 GGGCATCCCAGGCTGCTCCGGGG + Intergenic
1029422620 7:100479014-100479036 GGGCTTCAGAGGCCGCTCCTAGG - Exonic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1032130717 7:129225243-129225265 GGGGACCGGGGGCCGCTCCGCGG - Exonic
1033306859 7:140231335-140231357 GGGCTTCCCGGGCCGCTTCGGGG + Intergenic
1033477122 7:141702004-141702026 CCGCCTCCGGGGCGGCTCCGCGG + Exonic
1034733984 7:153412220-153412242 GAGCCACAGCGGCCGCTCCGAGG + Intergenic
1036032818 8:4992112-4992134 GGCCCTGCGGGGCAGCCCCGTGG - Intronic
1036786798 8:11693027-11693049 GCGCCTGCGGGGCCTCTGCGTGG + Intronic
1039579281 8:38650905-38650927 GGGCCTTCGGGGGCGCGACGCGG + Intergenic
1041304669 8:56446823-56446845 GGGCCACAGGGGGCGCTCGGTGG + Intergenic
1049183796 8:141238103-141238125 GGGCCACCTGTGCTGCTCCGTGG + Intronic
1049192785 8:141298007-141298029 GGGCCTCCCGGGCAGCGCTGTGG - Intronic
1049250721 8:141587565-141587587 GGGCCTCCAGGGCTGCTCAGCGG + Intergenic
1049555421 8:143279077-143279099 GGTCCTGCCGGGCCGCTCTGGGG - Intergenic
1049685754 8:143938723-143938745 GGGCCCCCGGGGCTTCTCCCAGG - Intronic
1050512742 9:6412679-6412701 GGGCCCCCGGGGCCTTTCCCGGG + Intergenic
1051418748 9:16870557-16870579 GCGCCACCGGGGCCGCCCGGGGG - Intronic
1056436248 9:86578189-86578211 GGGCCCCCGGAGCCGCTCTTGGG - Intergenic
1057995865 9:99821471-99821493 GCGCCTCCGAGGCTGCCCCGAGG - Intergenic
1058307374 9:103460386-103460408 GGACTTCCTGGGCCGCTTCGGGG - Intergenic
1060296530 9:122347149-122347171 CGGCCGCCCGGGCCGCTCCGCGG - Intergenic
1060545472 9:124456692-124456714 GCGCATTCGGGGCCGCTCTGAGG - Exonic
1060555351 9:124504915-124504937 CCGCCGCCGGGGCCGCTCCGAGG + Intronic
1062320443 9:135988192-135988214 GAGCCTCAGGGGCTGCTCCCCGG + Intergenic
1062325832 9:136012113-136012135 GAGCCTCCCCGGCCGCTCCTGGG + Intronic
1062469478 9:136696290-136696312 GGGCGCCCGGGGCCCCTCGGCGG - Intergenic
1062556374 9:137114923-137114945 GGGCCCCCGGGCCATCTCCGCGG + Intronic
1062584149 9:137241520-137241542 CGGCCGCCGGGCCCCCTCCGCGG + Intronic
1062737312 9:138144491-138144513 GAGCCTCAGGGGCAGCTCCGGGG + Intergenic
1062737323 9:138144525-138144547 GAGCCTCAGGGGCAGCTCCGGGG + Intergenic
1185457828 X:319507-319529 GGGACTCCGGGGCAGCTTCCGGG - Intergenic
1185747467 X:2584218-2584240 GGGGCTCCGGGCGCGCTCGGGGG - Intergenic
1187915628 X:24150047-24150069 GGGGCCCCGGGTCGGCTCCGCGG + Intronic
1187915722 X:24150353-24150375 GGGCCTCCGGGGCCCGTCACCGG - Intronic
1195766125 X:108298445-108298467 TGGCCTCCGGGCCCTCTCCCTGG + Intronic
1200062613 X:153490266-153490288 GGGCCTGCGTGGGGGCTCCGGGG - Intronic