ID: 1146439206

View in Genome Browser
Species Human (GRCh38)
Location 17:32878582-32878604
Sequence GACACTGATATCGAGACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146439206_1146439212 13 Left 1146439206 17:32878582-32878604 CCACCTGTCTCGATATCAGTGTC No data
Right 1146439212 17:32878618-32878640 TAAAAGCTCTGGAATAAGGTAGG No data
1146439206_1146439210 2 Left 1146439206 17:32878582-32878604 CCACCTGTCTCGATATCAGTGTC No data
Right 1146439210 17:32878607-32878629 CATTTGTGGAATAAAAGCTCTGG No data
1146439206_1146439213 25 Left 1146439206 17:32878582-32878604 CCACCTGTCTCGATATCAGTGTC No data
Right 1146439213 17:32878630-32878652 AATAAGGTAGGACTGTCCTATGG No data
1146439206_1146439211 9 Left 1146439206 17:32878582-32878604 CCACCTGTCTCGATATCAGTGTC No data
Right 1146439211 17:32878614-32878636 GGAATAAAAGCTCTGGAATAAGG No data
1146439206_1146439215 30 Left 1146439206 17:32878582-32878604 CCACCTGTCTCGATATCAGTGTC No data
Right 1146439215 17:32878635-32878657 GGTAGGACTGTCCTATGGTTGGG No data
1146439206_1146439214 29 Left 1146439206 17:32878582-32878604 CCACCTGTCTCGATATCAGTGTC No data
Right 1146439214 17:32878634-32878656 AGGTAGGACTGTCCTATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146439206 Original CRISPR GACACTGATATCGAGACAGG TGG (reversed) Intergenic
No off target data available for this crispr