ID: 1146445304

View in Genome Browser
Species Human (GRCh38)
Location 17:32928129-32928151
Sequence CCGGGAAGCGCCGCGGCCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146445304_1146445311 10 Left 1146445304 17:32928129-32928151 CCTAGGGCCGCGGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1146445311 17:32928162-32928184 TGCAGGCCCGCGCCCGCGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 186
1146445304_1146445318 27 Left 1146445304 17:32928129-32928151 CCTAGGGCCGCGGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1146445318 17:32928179-32928201 GCCCGGACTTTGCCATCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1146445304_1146445316 23 Left 1146445304 17:32928129-32928151 CCTAGGGCCGCGGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445304_1146445320 28 Left 1146445304 17:32928129-32928151 CCTAGGGCCGCGGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1146445320 17:32928180-32928202 CCCGGACTTTGCCATCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1146445304_1146445307 -7 Left 1146445304 17:32928129-32928151 CCTAGGGCCGCGGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1146445307 17:32928145-32928167 TTCCCGGCATGCTCCGCTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 86
1146445304_1146445317 26 Left 1146445304 17:32928129-32928151 CCTAGGGCCGCGGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1146445317 17:32928178-32928200 CGCCCGGACTTTGCCATCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146445304 Original CRISPR CCGGGAAGCGCCGCGGCCCT AGG (reversed) Exonic
900661712 1:3787967-3787989 CCAGGAAGCCCCGTGGCCCACGG + Intronic
904190315 1:28737748-28737770 CCGGGAAGCGCCCCGGGCGGAGG + Intronic
904591647 1:31618323-31618345 TCGGGGAGCGTCGCGGCCCTGGG + Intronic
913449764 1:118985250-118985272 CCGGGAAGAGACGCTGCCCTGGG + Intronic
916522948 1:165581627-165581649 CCCGGAGGCCCCGGGGCCCTGGG + Intergenic
921355432 1:214281029-214281051 CCGCCTAGCGCCGCGACCCTCGG - Intergenic
1068538615 10:58267849-58267871 CCGGGCAGCGCCGGGGCCGGCGG - Exonic
1073210129 10:101793685-101793707 CTGCGAAGCGCAGCGGCTCTAGG - Intronic
1076905187 10:133357823-133357845 CCGGGAAGGGCCGCGTCCTGGGG - Intronic
1077014017 11:392150-392172 CAGGGAGGCGCCGCAGCTCTGGG + Intergenic
1077049648 11:560958-560980 CCCGGGTGCGCCGCGGCGCTGGG + Intronic
1082986156 11:59172567-59172589 CCGCGCAGCGCCGCAGCCCCGGG + Exonic
1084519789 11:69656185-69656207 CAGGGCAGGGCCGGGGCCCTGGG + Intronic
1099973877 12:89526000-89526022 CCGGGAGGCGCTGCCGCTCTGGG - Exonic
1101482164 12:105108169-105108191 CCGGGAGGCCCAGCGGCCCCGGG + Intronic
1103713252 12:122928728-122928750 CCGGGAAGCACAGAGGCCCCTGG + Intronic
1104444753 12:128823993-128824015 GCGAGAAGGGCGGCGGCCCTGGG - Intergenic
1104660955 12:130611198-130611220 CCGGGAACCGCCGCAGCTCCTGG + Intronic
1104797060 12:131527289-131527311 CAGGGAGGCGCTGCGGCCCGTGG + Intergenic
1104929419 12:132329904-132329926 CCCGGAGGCCCCGCTGCCCTCGG - Intergenic
1105049741 12:133037708-133037730 CCGCGCAGCTCCGCGGCCCACGG - Exonic
1105806029 13:23952007-23952029 CCTGGAAGCGGCTGGGCCCTGGG + Intergenic
1105866918 13:24469042-24469064 CAGGTAAGCGCCATGGCCCTGGG + Exonic
1108065307 13:46571521-46571543 CCAGGAAGCTCCACAGCCCTTGG - Intronic
1108313891 13:49220111-49220133 CCGGGGCGGGCCGCGGCCGTGGG + Intergenic
1108615619 13:52129081-52129103 CAGGGAGGCGCAGCGGCCCCGGG - Intergenic
1110450594 13:75635465-75635487 GCGGTATCCGCCGCGGCCCTGGG - Intronic
1111951470 13:94712209-94712231 CCGGGGCGCGGCGTGGCCCTGGG - Exonic
1113848398 13:113404825-113404847 CCGGGAAGCCCGGCAGCCCAAGG - Intergenic
1114558613 14:23576410-23576432 CCGGGAAGCGCCACGGCTACGGG - Exonic
1115399127 14:32938777-32938799 CCCGGAGGCGGCGGGGCCCTGGG + Intronic
1119046329 14:71321144-71321166 CCGGGACGCGCGGCGGCACCGGG + Intronic
1122582199 14:102777767-102777789 CCGGGCAGCCCCGAGGCCCCCGG - Intronic
1122792575 14:104190552-104190574 CCGGGAAGCCCATCTGCCCTGGG - Intergenic
1122938807 14:104972105-104972127 CCGGCAAGTGCCCCTGCCCTGGG - Intronic
1126134708 15:45378666-45378688 TCGGGAAGCGCCGCGGCCGCTGG + Exonic
1128720020 15:69941409-69941431 CTGGGGACCGCCGAGGCCCTCGG - Intergenic
1130952850 15:88605825-88605847 CTGGACAGCGCCCCGGCCCTAGG + Intergenic
1131180160 15:90233950-90233972 CCGGGCAGTGACGCGGCCCAAGG - Exonic
1132092460 15:98957312-98957334 CCGAGAACGGCCCCGGCCCTGGG + Exonic
1132842276 16:1984013-1984035 CCGGCCAGCGCCGCGGCCTCTGG + Intronic
1137300612 16:47144286-47144308 CCGGGAAGCGCCGCCCACCTCGG + Intergenic
1140223006 16:73057944-73057966 CCGAGAGGCGCCGGGGCCCCGGG - Intronic
1140775520 16:78245815-78245837 CCTGGAAGCGCCCAGGCACTTGG - Intronic
1142337995 16:89502630-89502652 ACGGGAATCCCCACGGCCCTGGG - Intronic
1142549891 17:732274-732296 GCGGGAAGGGCCGCGGCTCCCGG - Intergenic
1142974577 17:3636017-3636039 CCTGGAGGCGGCGCGGCCCCGGG + Intronic
1146374231 17:32283784-32283806 CCGCGAGGCGCCGCGGTCCAAGG + Intronic
1146445304 17:32928129-32928151 CCGGGAAGCGCCGCGGCCCTAGG - Exonic
1146846424 17:36184094-36184116 CCCGGAAGAGCCGGGGTCCTGGG + Intronic
1147548685 17:41422710-41422732 CAGGGGAGCTCCCCGGCCCTGGG - Intronic
1149849777 17:60027509-60027531 CCCGGAAGAGCCGGGGTCCTGGG + Intergenic
1149860391 17:60119015-60119037 CCCGGAAGAGCCGGGGTCCTGGG - Intergenic
1151755728 17:76074428-76074450 CAGGGAAGCGCCGAGGCGCGCGG + Intronic
1152119319 17:78408549-78408571 CAGGGACGCGCAGCAGCCCTCGG - Intronic
1152422741 17:80202886-80202908 CAGGGAAGCCCCTCGGTCCTGGG + Intronic
1153005972 18:499444-499466 CCGGGAAGCCCCAAGGCGCTTGG - Intronic
1153382495 18:4454977-4454999 CCGGGCTGCGCCGCGGGGCTGGG - Intronic
1155392463 18:25351019-25351041 GCGCGAGGCGCCGCGGCCCGAGG - Intronic
1157766143 18:50298778-50298800 CCGGGAAGCCCCACAGCCCTGGG + Intergenic
1157825976 18:50812964-50812986 CCTGGAAGCTCCCCAGCCCTGGG - Intronic
1157833723 18:50879529-50879551 CCGGGTAGAGCCGCGGCCGCTGG - Intronic
1158931097 18:62325482-62325504 CCGGGAAGGGCCGGGGCCGGCGG + Intronic
1160540213 18:79617108-79617130 CTGGGAGGAGCCGCGGCCCCCGG + Intergenic
1160858248 19:1226976-1226998 CCTGGAAGCGGCGCGGGCATGGG - Intronic
1161169835 19:2807219-2807241 CAGGGAAGCGCCCGGGCCCTGGG + Intronic
1162589114 19:11579032-11579054 CCGGGAGGCGTGGCGGCTCTGGG - Intronic
1162745128 19:12793717-12793739 CCGGGCAGGGCCGCGGCGCCGGG + Intronic
1164455831 19:28405831-28405853 CCGGAGGGCGCCGCGTCCCTCGG - Intergenic
1165114551 19:33521386-33521408 CCGGGAAGCGCCCGGGTCCCTGG + Intronic
1165939791 19:39409499-39409521 CAGGTAAGCGCCGCGGGGCTCGG - Intergenic
1167781413 19:51601424-51601446 CCTGGAGGCGCCGCGGCCGTCGG + Intergenic
1168288742 19:55347055-55347077 CCCGGAAGCGCCGACGCCCCCGG + Exonic
925068743 2:950530-950552 CCACGATGCGCCGCGGACCTCGG + Intergenic
929758625 2:44788129-44788151 CCGGGCAGCACATCGGCCCTGGG - Intergenic
931018843 2:58018866-58018888 CCGGGAAGTGCTGAGGTCCTGGG - Intronic
931728108 2:65130266-65130288 CCGCCAAGCGCCGCGCCTCTGGG + Intergenic
932591617 2:73071108-73071130 CCGGGCAGCGTCGCGCCCCGCGG - Intronic
933772757 2:85754467-85754489 CCGGGGAGCGCGGGGGCTCTCGG + Exonic
935732215 2:106073569-106073591 CCGGGAAAGGCCTGGGCCCTGGG + Intronic
936082890 2:109446885-109446907 CAGGGAAGCGCTGTGGCCCTCGG - Intronic
942046035 2:172100161-172100183 CCGGGAAGCCTCGCGCGCCTGGG + Exonic
942458337 2:176152498-176152520 GCGGGGAGGGCCGCGGGCCTCGG + Intronic
947564777 2:231186630-231186652 ACAGGAAGCGCCGTGGGCCTGGG + Intergenic
948738324 2:240025434-240025456 CGGGGCCGCGCCGAGGCCCTCGG + Intergenic
948888502 2:240895895-240895917 CCGGGAGGCGCCGCGTGCCCAGG - Exonic
1176029667 20:63005873-63005895 GCGGGAAGCGCCAAGGCCGTCGG - Intergenic
1176297338 21:5081110-5081132 CCTGGAGGAGCCGTGGCCCTGGG - Intergenic
1179859691 21:44180838-44180860 CCTGGAGGAGCCGTGGCCCTGGG + Intergenic
1180040490 21:45276834-45276856 TCGGGAGGCGCCGGGACCCTGGG - Intronic
1180216078 21:46324512-46324534 CCGGGACGCGCGGCGCCTCTCGG + Intronic
1182462392 22:30491875-30491897 CAGGGAGGAGCCGCGGCCCACGG + Exonic
1182467358 22:30525652-30525674 CAGGGAGGAGCCGCGGCCCACGG + Exonic
1183201341 22:36387542-36387564 CCGGGGAGCGCCGGGTCCCGAGG + Intronic
1183528113 22:38336249-38336271 CCGGGAAGCGGCGCGGGGCTGGG - Intronic
1183931419 22:41238042-41238064 CCCGCAGGCGCCGCGGCCCCTGG + Exonic
1184813340 22:46852272-46852294 CCGGGAAGCCGGGAGGCCCTGGG - Intronic
1185097741 22:48820941-48820963 CCTGGAAGCTCCTCGGCACTGGG + Intronic
950633182 3:14297793-14297815 CCGGGAAGCGCGCAGGCTCTGGG + Intergenic
954339347 3:49940421-49940443 CCCGGAACCGTCGCGGGCCTGGG + Intronic
958779424 3:98522984-98523006 CCGGGCCGGGCCGCGGCCCGGGG + Intronic
961487486 3:127227185-127227207 CCCGGCAGCGCCGCGGTCCAAGG + Intergenic
962373326 3:134839524-134839546 CCTGAAAGCGCCTCTGCCCTTGG + Intronic
963733187 3:148991851-148991873 CCGGGCAGAGCCCGGGCCCTCGG + Intronic
965734885 3:171809933-171809955 CCAGGAAGTGCCGCGTCCCAAGG - Intronic
968433747 4:574925-574947 CTGCGAGACGCCGCGGCCCTGGG - Intergenic
968514312 4:1009893-1009915 ACGGGCAGCGTCGCGGCCCCTGG - Intergenic
969253815 4:5989386-5989408 CCGGGAAAGACCACGGCCCTGGG - Exonic
978126954 4:105146594-105146616 CCGGCCTGCGCCGCCGCCCTGGG - Exonic
979565753 4:122152519-122152541 CCGGGGAACGCCGAGGGCCTTGG - Exonic
986608662 5:9546272-9546294 CCGGGAAGGGGCGGGGCCCGGGG - Intergenic
999152338 5:149434514-149434536 CTGGGAAGAGCCTGGGCCCTAGG - Intergenic
1002006536 5:176238771-176238793 CCGGGGAGCGCGGCGGGCCGGGG + Intronic
1002219842 5:177671865-177671887 CCGGGGAGCGCGGCGGGCCGGGG - Intergenic
1002541116 5:179907374-179907396 CCGGGAAGCTGCACGGCCCCCGG + Intronic
1005514140 6:26538433-26538455 CCGTGACGCGCCGGAGCCCTAGG - Exonic
1007927662 6:45663298-45663320 CCGGGAGGCGCCGGGGCCTGGGG - Intronic
1009437536 6:63635698-63635720 CCGGGAAGCGCTGCAGCCCGGGG + Intergenic
1011643079 6:89433249-89433271 CTGGGCGGCGCCGAGGCCCTGGG + Intronic
1017014703 6:150090662-150090684 CCGGGAAGAGCCGCATCCCTGGG - Intergenic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1018091314 6:160348579-160348601 TCGGCCAGCGCCGCGGCACTTGG - Exonic
1019275051 7:171734-171756 CCCTGCAGCGCCGTGGCCCTGGG - Intergenic
1019293108 7:259984-260006 CCGGGCAGCGCAGCGGCCGGCGG - Exonic
1023000283 7:35801320-35801342 CCGGGAAGCTCTGCGGCCGCTGG + Intronic
1030033248 7:105388298-105388320 CCGGAAAGGGCCGCGACCCCCGG + Intronic
1035160712 7:156948702-156948724 CCGGGAAGAGAAGCGGCCCCTGG + Intergenic
1036789248 8:11707618-11707640 CCGGGAAGCCCCTGGTCCCTGGG + Intronic
1036930500 8:12951630-12951652 CCCGGAGGCGCCGCAGGCCTGGG + Intronic
1039542333 8:38382325-38382347 CCGGCAGGCGCCGCGGCCCGCGG - Intergenic
1041792709 8:61714625-61714647 CCGGGAAGGGGCGTGGCCGTCGG - Intronic
1044999748 8:97869190-97869212 CCGAGGAGAGCCGCGGCCCTCGG + Exonic
1045571338 8:103371664-103371686 CGGGGAGGCGGCGGGGCCCTGGG - Exonic
1049007011 8:139862197-139862219 CCAGGAAGAGCTGAGGCCCTGGG - Intronic
1049347476 8:142146565-142146587 CCGGGAGACGCCTCCGCCCTCGG + Intergenic
1049844258 8:144792433-144792455 CCGGAAGGTGTCGCGGCCCTGGG - Exonic
1052301364 9:26956388-26956410 CCGGGATACGCCGCGGCGCACGG + Intronic
1059134832 9:111795090-111795112 CTGGGCAGCGCCGAGGTCCTCGG + Intergenic
1059145519 9:111896567-111896589 GCGGAAAGCGCTGCAGCCCTGGG - Intergenic
1059426065 9:114221748-114221770 CCGGGAGGTGCTGTGGCCCTTGG - Intronic
1060141371 9:121213207-121213229 CCGTGAAGCCCAGCTGCCCTGGG - Intronic
1060763511 9:126275809-126275831 GCGGGAAGCCCCTCGGGCCTGGG + Intergenic
1060952605 9:127613115-127613137 CCGGGCCGCGCCGCGGTCCCTGG + Intronic
1060987552 9:127828444-127828466 TCGGGAAGCAGCGCGGCCCCAGG + Intronic
1061283682 9:129610749-129610771 CCGGGGCCCGCCGCGACCCTTGG + Intronic
1062274341 9:135723704-135723726 CCGGGAAGTGCCGTGTCCCAGGG + Intronic
1195256302 X:103094212-103094234 CCGGCCAGCGCTGCTGCCCTGGG + Intergenic
1200214034 X:154359555-154359577 CCGGGAGGGGTCGCAGCCCTCGG + Exonic
1200223321 X:154402872-154402894 CAGGGAAGCCCCTCGGCCCCGGG - Intronic
1200266656 X:154649772-154649794 CCGGCCAGGGTCGCGGCCCTGGG + Intergenic
1202605181 Y:26633363-26633385 CAGGTAAGCGCCATGGCCCTGGG + Intergenic