ID: 1146445308

View in Genome Browser
Species Human (GRCh38)
Location 17:32928147-32928169
Sequence GGCCTGCAGCGGAGCATGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146445308_1146445322 19 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445322 17:32928189-32928211 TGCCATCGGCGGGGCAGTCGCGG 0: 1
1: 0
2: 1
3: 4
4: 44
1146445308_1146445323 20 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445323 17:32928190-32928212 GCCATCGGCGGGGCAGTCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1146445308_1146445318 9 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445318 17:32928179-32928201 GCCCGGACTTTGCCATCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1146445308_1146445325 30 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445325 17:32928200-32928222 GGGCAGTCGCGGGATGCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1146445308_1146445316 5 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445308_1146445320 10 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445320 17:32928180-32928202 CCCGGACTTTGCCATCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1146445308_1146445317 8 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445317 17:32928178-32928200 CGCCCGGACTTTGCCATCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
1146445308_1146445311 -8 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445311 17:32928162-32928184 TGCAGGCCCGCGCCCGCGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146445308 Original CRISPR GGCCTGCAGCGGAGCATGCC GGG (reversed) Exonic
901004890 1:6166796-6166818 GGCCGCCAGGGGAGCCTGCCAGG + Intronic
901746411 1:11376727-11376749 GTTCTGCAGGGGAGCATGGCTGG + Intergenic
903047645 1:20576211-20576233 GGCCTGCAGAGGAGGATGCTGGG - Intergenic
903786277 1:25863324-25863346 AGCCTGCACCTGGGCATGCCAGG + Exonic
904418539 1:30377127-30377149 AGCCAGCAGCCGAGAATGCCAGG + Intergenic
904620801 1:31773854-31773876 GGCCTGTAGCTGAGCATTACTGG - Intergenic
906434889 1:45787017-45787039 GGCTTGCAGAGGTACATGCCTGG - Intronic
907802883 1:57789211-57789233 TGCCTGCAAGGGAGAATGCCAGG + Intronic
908939192 1:69410872-69410894 GACCTGCAGCTGTGAATGCCAGG + Intergenic
911188751 1:94927410-94927432 GGCCCGCCGCGGAGGATGCCTGG - Intergenic
912568789 1:110607139-110607161 AGCCTGCAGCGCAGCAGGCTTGG - Intronic
913107220 1:115625538-115625560 GGCCTGCAGAGAAGCCTGGCGGG + Intergenic
917508000 1:175646638-175646660 GGCCTGCAGCTGTGTTTGCCTGG + Intronic
921506719 1:215980107-215980129 GTTGTGCAGGGGAGCATGCCAGG + Intronic
922477041 1:225913647-225913669 GGGCTGCAGCAGAGCATGTGAGG - Intronic
922536155 1:226382396-226382418 GCACTGCAGAGGAGCATCCCAGG - Intronic
922569369 1:226624729-226624751 GGGCTGCAGCTGGGGATGCCAGG + Intergenic
922611317 1:226931191-226931213 GGCCTGCAATGGTGCATTCCCGG + Intronic
1062804871 10:411036-411058 GGGCTGAACCGGAGCAAGCCCGG + Intronic
1067080833 10:43211404-43211426 GGCCTGGAGTGGAGGCTGCCTGG + Intronic
1067204248 10:44199921-44199943 GGCGTGGAGAGGAGCCTGCCTGG - Intergenic
1067213209 10:44278995-44279017 GGCCTGCACCTGGGCCTGCCAGG + Intergenic
1067562909 10:47316370-47316392 CGTCTGCAGCAGCGCATGCCAGG + Intergenic
1069576982 10:69537788-69537810 GGCCTCCATCAGATCATGCCAGG - Intergenic
1076729165 10:132429692-132429714 GGCCTGCAGCCTGGCTTGCCAGG - Intergenic
1076729785 10:132432477-132432499 GGGCTGCCCCGGAGCATCCCTGG - Intergenic
1076782883 10:132734143-132734165 CGCCTGCAGCGATGCATCCCTGG - Intronic
1078420761 11:11210255-11210277 CTGCTGCAGCAGAGCATGCCAGG - Intergenic
1079592220 11:22193802-22193824 GGCCTGCAGGGGAGCAAGGAGGG - Intronic
1083681229 11:64352740-64352762 GGCCTGCAGCTGCTCGTGCCTGG - Exonic
1084192564 11:67505461-67505483 CGCCTGCAGCGGAGGAGGCAGGG + Intronic
1084664790 11:70570556-70570578 GGCCTGCAGCAGAGCAGGTGAGG - Intronic
1088223217 11:107591182-107591204 CGCGTGGAGCGGAGCAAGCCGGG - Intronic
1089511132 11:118998062-118998084 GGCTTGCAGTGGCGCCTGCCGGG + Intergenic
1089556169 11:119316975-119316997 GGTCTGCGGTGGAGCGTGCCAGG - Intronic
1089792223 11:120953431-120953453 GGGCTGCAGTGGAGCAGGCCAGG + Intronic
1091718539 12:2795895-2795917 GGCCGGGCGCGGGGCATGCCGGG + Intronic
1093736377 12:22625158-22625180 GGGCGGCCGCAGAGCATGCCGGG - Exonic
1096380270 12:51151178-51151200 CGGCTGCAGCAGAGCAAGCCAGG + Intronic
1096545424 12:52335846-52335868 GGTCTGCAGCTGAGCGGGCCTGG - Intergenic
1096841958 12:54385234-54385256 GACCTGTAGCTGAGCATTCCTGG - Intronic
1097904984 12:64910272-64910294 GGCCTGCACAGGAACATGCAGGG + Intergenic
1104602327 12:130162269-130162291 GGCCTGCAGCCCAGCCTGCGGGG - Intergenic
1104825916 12:131709771-131709793 GGCCAGCAGCTGAGCATGCGTGG - Intergenic
1104895336 12:132161095-132161117 GGCCTGCGGTGGAGCAGGCCTGG - Intergenic
1104992489 12:132633996-132634018 GCCCTCCAGTGGAACATGCCTGG + Intronic
1106337407 13:28796352-28796374 GGCGTGCAGAGGGTCATGCCTGG - Intergenic
1112356006 13:98675436-98675458 GGCCGGAGGCGGGGCATGCCTGG - Intergenic
1113637200 13:111927733-111927755 GGCCTTGAGCGGAACATGCACGG + Intergenic
1113925932 13:113941697-113941719 GGCCTTCAGCACAGCACGCCAGG + Intergenic
1114554150 14:23551816-23551838 CGCCCGCCGCGGCGCATGCCGGG + Intronic
1120844777 14:89116153-89116175 GCCCTGAAGTGAAGCATGCCTGG - Intergenic
1122829588 14:104389295-104389317 GGCCTGCAGTGGAAGAAGCCCGG - Intergenic
1122842170 14:104471298-104471320 GGCCTGGCTCGGAGGATGCCAGG + Intergenic
1122865402 14:104601764-104601786 GGCCTGTGGCGGAGCATTTCAGG - Intronic
1124237763 15:28004421-28004443 GGGCTGCAGGGGAGCCTGCGGGG + Intronic
1125694090 15:41621187-41621209 GGTGTGCTGCAGAGCATGCCGGG - Intergenic
1126738029 15:51751539-51751561 CGGCTGCAGCGGAGCAGGCTGGG - Exonic
1126793549 15:52242068-52242090 GGCCTACAGCCGAGGATTCCTGG - Exonic
1127975707 15:63995778-63995800 GTCCTGCTGCAGAGCGTGCCTGG + Intronic
1127997755 15:64163316-64163338 GGCGGGCCGCGGAGCATGCCGGG - Intergenic
1130657069 15:85799150-85799172 GGTCTGGAGCAGAGCATGTCAGG - Intergenic
1131417573 15:92273879-92273901 GACCTGCAGCAGAGCCCGCCTGG + Intergenic
1132673147 16:1110055-1110077 GGGCTGCAGCAGAACCTGCCTGG - Intergenic
1132700240 16:1219146-1219168 GGCCTGCAGCAGAGGCTGGCGGG + Intronic
1132849909 16:2020291-2020313 GGACTTCAGCGGAGCTGGCCAGG + Exonic
1133304364 16:4800424-4800446 GGCCTGCCGCGGGGCCTCCCTGG - Intronic
1133367924 16:5225797-5225819 AGCCTGCAGCTGAGCATAGCAGG + Intergenic
1133631501 16:7626296-7626318 GGCATGCAGGGGATCATTCCTGG - Intronic
1134231899 16:12436176-12436198 GGGCTGCAGCAGAGCATAGCAGG - Intronic
1135722047 16:24826345-24826367 GACCTGCAGCTGACCATGCTGGG + Intronic
1138359876 16:56419072-56419094 GGACTGCAGCGGCGCATTCTTGG + Intronic
1139776313 16:69319043-69319065 GGCCTGCAGAGGGCCAGGCCTGG + Intronic
1140765126 16:78150301-78150323 TGCCTGGAGAGGGGCATGCCGGG - Intronic
1140979464 16:80092925-80092947 CGCCAGGAGCGGAGCTTGCCTGG - Intergenic
1141320954 16:83008415-83008437 GCCCTGAGGCGGAGAATGCCTGG + Intronic
1144495888 17:15744531-15744553 GGCCTGCATGGGGGCATCCCTGG - Intronic
1146445308 17:32928147-32928169 GGCCTGCAGCGGAGCATGCCGGG - Exonic
1147921641 17:43920840-43920862 GGCGTGGAGGGGAGCACGCCAGG + Intergenic
1149862026 17:60127190-60127212 GGCCAGCATCAGAGCATCCCTGG - Intergenic
1152457281 17:80423642-80423664 GGCCTGCTGCAGGCCATGCCCGG + Intronic
1152722916 17:81931608-81931630 GGCCTTCAGGGGAGCCTGCAGGG + Intergenic
1153774014 18:8437159-8437181 GGCCAGCAGCGGTGCTTCCCAGG - Intergenic
1154072377 18:11164429-11164451 CGCCTGCATCTGAGCATGCCAGG + Intergenic
1154239900 18:12643535-12643557 GCCCTGCAGAGAAGCATCCCAGG + Intronic
1154349358 18:13570226-13570248 GGTCTGCACCGGAGCATGTGGGG + Intronic
1156219931 18:35041220-35041242 GGCCTGCCCCGGTGCCTGCCTGG + Intronic
1160014528 18:75129861-75129883 CGCATGCAGAGGAGCAGGCCGGG + Intergenic
1160608179 18:80067564-80067586 GGCCTGCAGACCAGTATGCCTGG + Intronic
1161454478 19:4363152-4363174 GGCCTGCATCGGGGCAGGGCTGG + Intronic
1161854348 19:6754797-6754819 GGCCTGGGGAGGAGCATCCCAGG + Intronic
1163315682 19:16539010-16539032 GGCCTGCAGGGGAGCAAACAGGG - Intronic
1163633528 19:18428508-18428530 GGCCTGGAGTGGAGGCTGCCTGG + Intronic
1164267289 19:23631897-23631919 GGACTACAGGGGTGCATGCCTGG + Intronic
1165782694 19:38443155-38443177 GGGCTGCAGCGCAGCATGATGGG + Intronic
1166864927 19:45830053-45830075 GGCCTGCAGCGGGGCAGCCCAGG - Exonic
1168577747 19:57527453-57527475 CGCCCGCAGAGGAGCTTGCCTGG + Exonic
927904607 2:26847910-26847932 GCCCTGCAGCAGGGCCTGCCGGG + Intronic
928124056 2:28604026-28604048 GGCCTTCAGCCGAGCCTACCGGG + Exonic
928225121 2:29441825-29441847 GGGCTGCAGAGGAACATTCCTGG - Intronic
932008700 2:67954017-67954039 GGACTGCAGAGTAGCAGGCCAGG + Intergenic
934708809 2:96502426-96502448 GGCCAGCAGCAGGGCAGGCCTGG - Intronic
938200578 2:129369326-129369348 GGCCAGGGGCGCAGCATGCCAGG - Intergenic
948975226 2:241459697-241459719 GGCCTGCAGCCCAGCTTGCTGGG + Intronic
1170814297 20:19699704-19699726 GGCCTGCAGCTGACCACGCTGGG - Intronic
1175083480 20:56440249-56440271 AGACAGCAGCTGAGCATGCCAGG - Intronic
1175870648 20:62208052-62208074 GGCCTCCAGGGGAACAGGCCTGG + Intergenic
1175944489 20:62552348-62552370 GGTCTGCAGCTGGGCATGGCTGG - Intronic
1176231662 20:64036166-64036188 GGACTGCAGAGGGGCAGGCCAGG - Intronic
1179566222 21:42250797-42250819 TGCCAGCAGCACAGCATGCCAGG - Intronic
1181078068 22:20394508-20394530 GGCCTGCAGCGGAGCCCCGCGGG - Intronic
1182473459 22:30562583-30562605 TGCCTGCAGCGGGGCATGGAAGG - Intronic
1182894531 22:33848438-33848460 GGCCTGCAGGGGTGCAGGGCTGG - Intronic
1184045747 22:41971374-41971396 GACCAGCAGCTGAGCATGCCGGG - Intergenic
1184431859 22:44445656-44445678 GGCATGCAGTGGAGGAAGCCAGG + Intergenic
1185210021 22:49565432-49565454 GGTCTGCAGCGGAGGGTCCCTGG + Intronic
950447190 3:13045119-13045141 GCCCTGGGGTGGAGCATGCCTGG - Intronic
953448979 3:42990753-42990775 GGCCTGCAGAACAACATGCCTGG - Intronic
953453716 3:43025154-43025176 GGCCTGCAGAGGAGCAGGAGTGG + Intronic
956195761 3:66651779-66651801 GACCTGCAGCCCACCATGCCTGG + Intergenic
960845118 3:121997717-121997739 GGCCTACTGCTGGGCATGCCTGG + Intronic
963123803 3:141797327-141797349 GGCCTGGGGCCGAGCATGCGGGG + Intronic
969673481 4:8602269-8602291 GGACTGCTGCGGATCATGCAGGG - Intronic
969956672 4:10897769-10897791 GGAGTGCAGTGGCGCATGCCCGG + Intergenic
979010074 4:115355742-115355764 TGCCTGCAATGGAGCATGGCTGG - Intergenic
982172364 4:152674507-152674529 AGCCGGCAGTGGAGCAAGCCAGG - Intronic
982721915 4:158868517-158868539 GGCTTGCAGCGCAGGGTGCCTGG + Exonic
984929785 4:184836902-184836924 GGCCTGCAGTGGACCCAGCCTGG - Intergenic
985629809 5:1008628-1008650 GTGCTGCAGCGGAGCCTGGCGGG - Intergenic
988672928 5:33401428-33401450 GCCCTGCAGAGCAGCATGGCTGG - Intergenic
991371251 5:65922989-65923011 GGCCTGCAGCTGAGGTTGCCTGG + Intergenic
993899971 5:93578749-93578771 CTCCTGCAGCTGAGCGTGCCTGG + Intergenic
995142512 5:108749225-108749247 CGCCCGCAGCAGAGCATTCCTGG + Intronic
1002091649 5:176810087-176810109 GGACTGCAGCGGAACCTGCCCGG + Intergenic
1002424874 5:179169020-179169042 GGCCTGCACTGGCTCATGCCTGG - Intronic
1006630582 6:35427329-35427351 GGCCTGCAGGTGAGCAGGCAGGG + Exonic
1006988629 6:38194146-38194168 GGCCGGCAGGGGAGCCTGCAAGG + Intronic
1006998142 6:38282698-38282720 GCCCTGGAGTGGAGCTTGCCTGG - Intronic
1008511955 6:52284479-52284501 GTGCCGCAGCGGAGCCTGCCGGG - Intronic
1010810070 6:80290457-80290479 CGCCCACTGCGGAGCATGCCTGG + Intronic
1015917156 6:138228818-138228840 TGCCTGCAGCTTAGCCTGCCAGG - Intronic
1017819547 6:158039425-158039447 GGTCTGCAGGGGAACCTGCCTGG + Intronic
1018676503 6:166226645-166226667 GTCCTGCAGCTTAGCCTGCCTGG - Intergenic
1018785642 6:167105818-167105840 GGCCTGGACCTGAGCAGGCCTGG - Intergenic
1019083751 6:169455064-169455086 GGCCTGCAGCTGAGCCCTCCCGG + Intergenic
1019356292 7:581363-581385 GGCCTGCTTGGGAGCACGCCTGG - Intronic
1024001911 7:45195306-45195328 GGGCTGCAGCCAAGCATTCCAGG - Intergenic
1024199084 7:47088402-47088424 GGCCAGCAGCTCAGCATGCCGGG + Intergenic
1024222411 7:47298980-47299002 GGCCTGCAGCCGCCCATGCAAGG + Intronic
1024559291 7:50629821-50629843 GGTCTCCTGCGGAGCAGGCCTGG + Intronic
1026895877 7:74009885-74009907 GGCAGGCAGCGGTGCATTCCAGG - Intergenic
1029424251 7:100486566-100486588 TGCCTGCAGGGGAGCATCCCTGG - Intronic
1030782340 7:113617105-113617127 GGCCTGCAGCGGAGTACACAAGG - Intergenic
1034264112 7:149773078-149773100 CGCCTGCAGAGGAGCCTCCCCGG + Intronic
1035476649 7:159148866-159148888 TGCCTGGGGCGGAGCGTGCCTGG - Intergenic
1040440646 8:47438107-47438129 GGCAGGCAGCTGAGCATGGCTGG + Intronic
1040459401 8:47632898-47632920 GGCCTGCAGCGGAAGCTCCCAGG + Intronic
1042668339 8:71232345-71232367 GGCATGCAGCGGAGCCTGGCTGG - Intronic
1049180065 8:141217669-141217691 GGCCTGCTGTTGACCATGCCAGG - Intronic
1049550371 8:143255067-143255089 CGCCTGCAGCAGCGCATGGCTGG + Intronic
1051121412 9:13756295-13756317 GGCCTGCAGCAGACCATTTCTGG + Intergenic
1053459563 9:38257952-38257974 GGCCTGCAGTGGAGCAAGGTTGG - Intergenic
1057221608 9:93260536-93260558 GGCCTGGGGTGGAGCATCCCTGG + Intronic
1057260170 9:93578431-93578453 GGCCAGCAGCTCAGCATCCCTGG - Intronic
1059204066 9:112446744-112446766 GTCCTGCAGTGGAGCATCCTGGG - Intronic
1060108830 9:120891983-120892005 GGCCTCCAGGGGACCATGCGGGG + Intronic
1185745050 X:2565906-2565928 GCCCTGCAGAGGAGCATGGGTGG - Intergenic
1187259233 X:17669897-17669919 GGCCTGGAGCAGAGCATTCAGGG - Intronic
1190220392 X:48509019-48509041 GGCCTGCGGGGGAGGCTGCCCGG + Intronic
1201166633 Y:11214961-11214983 GTCCTGTAGCTGAGCAGGCCTGG - Intergenic