ID: 1146445309

View in Genome Browser
Species Human (GRCh38)
Location 17:32928148-32928170
Sequence GGGCCTGCAGCGGAGCATGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 235}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146445309_1146445326 30 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445326 17:32928201-32928223 GGCAGTCGCGGGATGCGCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1146445309_1146445323 19 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445323 17:32928190-32928212 GCCATCGGCGGGGCAGTCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1146445309_1146445316 4 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445309_1146445325 29 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445325 17:32928200-32928222 GGGCAGTCGCGGGATGCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1146445309_1146445311 -9 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445311 17:32928162-32928184 TGCAGGCCCGCGCCCGCGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 186
1146445309_1146445320 9 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445320 17:32928180-32928202 CCCGGACTTTGCCATCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1146445309_1146445322 18 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445322 17:32928189-32928211 TGCCATCGGCGGGGCAGTCGCGG 0: 1
1: 0
2: 1
3: 4
4: 44
1146445309_1146445318 8 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445318 17:32928179-32928201 GCCCGGACTTTGCCATCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1146445309_1146445317 7 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445317 17:32928178-32928200 CGCCCGGACTTTGCCATCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146445309 Original CRISPR GGGCCTGCAGCGGAGCATGC CGG (reversed) Exonic
900242435 1:1623473-1623495 GGGCGTGCAGGTGGGCATGCGGG + Exonic
900515371 1:3079357-3079379 GGGCCAGCAGGGCAGCATGAAGG - Intronic
900573751 1:3372912-3372934 GGGCCTGATGCAGAGCCTGCGGG + Intronic
901667894 1:10836861-10836883 GGGCCCGCAGAGGAGGAAGCTGG + Intergenic
903047646 1:20576212-20576234 GGGCCTGCAGAGGAGGATGCTGG - Intergenic
903291302 1:22315907-22315929 CGGCCTGCTGCGGAGGAGGCTGG + Intergenic
903476699 1:23624386-23624408 GGGCCTGCAGCACACCATTCTGG + Intronic
903816213 1:26066308-26066330 CGGCCTGCAGAGGAACCTGCTGG - Exonic
904405540 1:30285881-30285903 GGGCCTGCAGGAGGGCAAGCAGG + Intergenic
904458526 1:30661845-30661867 GGGCCTGCAGGAGGGCAAGCAGG + Intergenic
907672792 1:56491782-56491804 GGGCTTGGCTCGGAGCATGCTGG - Intergenic
908419671 1:63947560-63947582 GAGCCTGCAGTGGAGCTGGCTGG - Intronic
913107219 1:115625537-115625559 GGGCCTGCAGAGAAGCCTGGCGG + Intergenic
914505853 1:148288281-148288303 GGGCCTGCAGAGGAGCTTTAGGG - Intergenic
915556002 1:156661158-156661180 GGGCCTGAAGAGGAGAAGGCTGG + Intergenic
918122193 1:181549829-181549851 GGGCGTGGAGTGGAGCATGGCGG + Intronic
921060129 1:211578567-211578589 GGGCCGGCTGCTGTGCATGCTGG - Exonic
922117636 1:222629816-222629838 GGGCTTGCAGGGGAGCCTGAGGG + Exonic
922726168 1:227924031-227924053 GGGGCTGCAGCAGGGCAGGCAGG - Intronic
923141346 1:231163193-231163215 CGGCCTGCGGCGGTGCAGGCGGG + Exonic
1062843914 10:690086-690108 GCGCGTCCAGCGGAGCCTGCGGG + Intergenic
1064118920 10:12602744-12602766 GGGCCTGCAGAGACGCATGGAGG + Intronic
1064143282 10:12807789-12807811 GGGCCTGCAGTGGAGCTGGACGG - Intronic
1066336338 10:34481982-34482004 GTGCCTGTAGCTGAGCATGGTGG - Intronic
1067711738 10:48655993-48656015 GGGCCTCCAGCAGAGCGGGCGGG + Intronic
1072821821 10:98565989-98566011 AGGCCTGGAGGGGAGCATGTTGG - Intronic
1073135413 10:101217544-101217566 GGGCCTGGAGCGGACAATTCGGG - Intergenic
1074153679 10:110780876-110780898 GGGCCTGCAGTTGAGCCAGCTGG - Exonic
1075588648 10:123675908-123675930 GTTCCTGCAGCTGAGGATGCTGG - Intronic
1075680729 10:124329388-124329410 GGGCATGAAGTGAAGCATGCTGG - Intergenic
1076165749 10:128281146-128281168 TGGCCTGCAGCAGAGCCTCCCGG - Intergenic
1076712084 10:132342539-132342561 GGGCCTGCAGAGGTGTGTGCGGG - Intronic
1078102058 11:8335949-8335971 GGGTCTACAGAGGAGAATGCTGG + Intergenic
1079084770 11:17437472-17437494 GGGCCAGGGGAGGAGCATGCAGG + Intronic
1079148606 11:17876894-17876916 GGTCCTGCTGCAAAGCATGCAGG + Intronic
1079266062 11:18934316-18934338 GTCCCTGCTGCGGAGCATCCTGG - Exonic
1079592221 11:22193803-22193825 AGGCCTGCAGGGGAGCAAGGAGG - Intronic
1083262392 11:61530345-61530367 GGGCCTGCGGTGGCGCTTGCAGG - Intronic
1083334579 11:61915198-61915220 GGGGGTGCAGGGGTGCATGCAGG + Intronic
1083683017 11:64359899-64359921 GGGCCTGCTGCGAGGCATGGGGG - Intronic
1083711955 11:64555041-64555063 GGGCCCGCAGCTGAGCAGGCGGG - Intergenic
1083722416 11:64609923-64609945 GGGGCTGCAGTGGGGCAGGCGGG - Intronic
1083997862 11:66280907-66280929 GGGCTGGCAGAGGAGCCTGCTGG - Intronic
1084047725 11:66579734-66579756 TGGCCTGCAGAGGAGCTTGTTGG - Intergenic
1084192563 11:67505460-67505482 CCGCCTGCAGCGGAGGAGGCAGG + Intronic
1086424762 11:86672354-86672376 GGTCCCGCTGCGGAGCAGGCGGG + Exonic
1087813212 11:102630947-102630969 GGGCCTGGAGAGGAGTGTGCTGG + Intergenic
1088598199 11:111455346-111455368 GCGCCTGCAGGTGAGCAGGCAGG + Intronic
1088646251 11:111918983-111919005 GGGTCTGCTGCGGAGGAAGCTGG + Exonic
1088745650 11:112801893-112801915 TGGCCTGCAGCAGAGGAGGCAGG + Intergenic
1089511131 11:118998061-118998083 GGGCTTGCAGTGGCGCCTGCCGG + Intergenic
1092206928 12:6620456-6620478 CGGGCTGCTGCGGAGCAAGCTGG - Exonic
1096531510 12:52245504-52245526 CGCCCTGCAGCGGGGCAAGCAGG + Exonic
1096717742 12:53501281-53501303 GGGCCCGCCGCGGGGCACGCTGG - Exonic
1097904983 12:64910271-64910293 AGGCCTGCACAGGAACATGCAGG + Intergenic
1099228194 12:79993563-79993585 AGGACTGCAGCGGTGCTTGCGGG - Intergenic
1102688536 12:114742541-114742563 GGGCCTGCATTGGATCAGGCAGG + Intergenic
1104602328 12:130162270-130162292 CGGCCTGCAGCCCAGCCTGCGGG - Intergenic
1104962297 12:132493989-132494011 GGACCTGCAGAGGGGCGTGCTGG + Intronic
1106346696 13:28886309-28886331 GGGCCAGCAGGGGAGCAGGGAGG + Intronic
1106553602 13:30791683-30791705 GGGCCTGCTGGGGAGCCAGCAGG + Intergenic
1106760018 13:32859016-32859038 AGGCCTGCAGCAGATCCTGCAGG + Intergenic
1107486795 13:40835543-40835565 GGGCCTGAGTCGGAGAATGCTGG + Intergenic
1112353417 13:98655140-98655162 TGGCTTCCAGTGGAGCATGCGGG + Intergenic
1118520369 14:66576127-66576149 GAGCCTGCAGCTGTGGATGCTGG + Intronic
1122193699 14:100068590-100068612 GGGCCAGCAGTGGAGCAGTCAGG + Intronic
1122371788 14:101233151-101233173 GGGGCCGCAGAGGCGCATGCAGG - Intergenic
1123069705 14:105636498-105636520 GGGCTTGCAGAGCAGCAAGCAGG - Intergenic
1123088787 14:105732217-105732239 GGGCTTGCAGAGCAGCAAGCAGG - Intergenic
1123094725 14:105761540-105761562 GGGCTTGCAGAGCAGCAAGCAGG - Intergenic
1123783150 15:23646143-23646165 GGGCCGGCAGCCTAGCCTGCGGG + Exonic
1124237762 15:28004420-28004442 TGGGCTGCAGGGGAGCCTGCGGG + Intronic
1125578970 15:40772615-40772637 GGGCAGGCAACGGAGCAGGCTGG + Intronic
1125723734 15:41857467-41857489 GCGTCTGCGGCGGAGCATGGAGG - Exonic
1125862172 15:43009273-43009295 GTCCCTGCAGCGGAACCTGCTGG + Intronic
1126475678 15:49063095-49063117 GGACGTGGAGGGGAGCATGCTGG - Intergenic
1126738030 15:51751540-51751562 GCGGCTGCAGCGGAGCAGGCTGG - Exonic
1127997756 15:64163317-64163339 GGGCGGGCCGCGGAGCATGCCGG - Intergenic
1128046084 15:64618755-64618777 GGGCGTTGAGAGGAGCATGCCGG - Intronic
1129061213 15:72861734-72861756 GGGGCTGCAGGGCAGCAGGCAGG - Intergenic
1129885097 15:79031970-79031992 GGGCCAGCAGCCGACAATGCTGG - Intronic
1130064644 15:80593781-80593803 GGGCCTGCGGCAGGGCAAGCAGG - Exonic
1130091454 15:80824504-80824526 GGGTCTGGAGCAGAGGATGCTGG - Intronic
1131905630 15:97138991-97139013 AGGCCTGCAGCAGAGCATCCAGG - Intergenic
1132656122 16:1042698-1042720 GGGGCTGCAGAGAAGCAGGCAGG + Intergenic
1132745619 16:1435002-1435024 GCGCCTGCAGCAGGGCAGGCGGG + Intronic
1133305293 16:4804509-4804531 CGGCCTGCAGGTGAGCATGGAGG - Exonic
1134621392 16:15692184-15692206 GGGCCTGCGGCGAAGGCTGCAGG - Intronic
1135722046 16:24826344-24826366 AGACCTGCAGCTGACCATGCTGG + Intronic
1136056746 16:27695375-27695397 GGGGCTGGAGCGGAGCCAGCAGG - Intronic
1136394840 16:29987224-29987246 GGGCCAGCAGCGCTGCCTGCAGG - Exonic
1140209414 16:72958986-72959008 GGGCCAGCGGCGGAGCCCGCTGG + Exonic
1140765127 16:78150302-78150324 GTGCCTGGAGAGGGGCATGCCGG - Intronic
1141815043 16:86404087-86404109 GAGTCTGCAGTGGAGCAGGCAGG + Intergenic
1141998189 16:87648182-87648204 GGCCCTGCAGCCCAGAATGCAGG - Intronic
1143725187 17:8839665-8839687 GGACCTCCAGAGGAGCGTGCAGG - Exonic
1144653778 17:17022603-17022625 GGGGCTGGAGCTGAGCCTGCTGG + Intergenic
1144848217 17:18230982-18231004 GGCCAGGCAGCGGAGCATGTGGG - Intronic
1146176378 17:30668401-30668423 GGGCCTGGAGGGGGGCAGGCGGG + Intergenic
1146349838 17:32084515-32084537 GGGCCTGGAGGGGGGCAGGCGGG + Intergenic
1146409081 17:32566474-32566496 TGGCCTGCAGGTGAGCCTGCAGG + Intronic
1146445309 17:32928148-32928170 GGGCCTGCAGCGGAGCATGCCGG - Exonic
1147157711 17:38552562-38552584 GGGCCTGCAGAGCAAGATGCGGG - Exonic
1147508749 17:41047112-41047134 GCGCGTGCAGCGGGGCACGCAGG + Exonic
1147509488 17:41055056-41055078 GCGCGTGCAGCGGGGCACGCAGG + Exonic
1147509996 17:41059895-41059917 GCGCGTGCAGCGGGGCACGCAGG + Exonic
1147510589 17:41065690-41065712 GCGCGTGCAGCGGGGCACGCAGG + Exonic
1148806243 17:50265434-50265456 TGGCCTGCAGGGGAGTCTGCTGG - Intergenic
1148984590 17:51610655-51610677 GGGGCTGCAGGGGAGCCTTCTGG + Intergenic
1152096949 17:78278146-78278168 GGGCCTCCAGGGGAGCAGGTGGG - Intergenic
1152604474 17:81282248-81282270 CAGCCTGCAGCGGAACATGATGG - Exonic
1152722915 17:81931607-81931629 GGGCCTTCAGGGGAGCCTGCAGG + Intergenic
1152886288 17:82852461-82852483 GAGCCTGCTGCCGAGCCTGCTGG - Intronic
1153137231 18:1930231-1930253 GGGCCCTCAGTGGTGCATGCAGG - Intergenic
1154349357 18:13570225-13570247 CGGTCTGCACCGGAGCATGTGGG + Intronic
1155257590 18:24012473-24012495 GGCCCTGCAGCTGAGGATGTGGG - Intronic
1160017883 18:75158135-75158157 GGGCATGCAGCGGGGAAGGCAGG - Intergenic
1160192156 18:76723276-76723298 GGGCCTGCAGTGGAACTTCCTGG - Intergenic
1160675885 19:390984-391006 GGGCCTGCAGTGGAGCAGCGTGG - Intergenic
1161317370 19:3623906-3623928 GAGCCAGCAGCAGAGCCTGCAGG - Exonic
1161616313 19:5272657-5272679 GGGCCTGCAGTGCTGCTTGCTGG - Intronic
1161817883 19:6510987-6511009 GAACCTGCAGCCGAGCTTGCTGG - Intergenic
1162966839 19:14160156-14160178 GGGCCTGCAGCTGGGCATCCAGG + Exonic
1162982447 19:14248496-14248518 GGGCCTGGAGGGGGGCAGGCGGG - Intergenic
1163315683 19:16539011-16539033 AGGCCTGCAGGGGAGCAAACAGG - Intronic
1164051143 19:21586592-21586614 GGACAAGCAGCGGAGCCTGCGGG + Intergenic
1164717524 19:30404358-30404380 TGGCCTGCAGTTGAGGATGCTGG - Intronic
1165738761 19:38193551-38193573 GGGCCTGCAGCGGACGCTGTCGG + Exonic
1165782693 19:38443154-38443176 CGGGCTGCAGCGCAGCATGATGG + Intronic
1166861827 19:45815744-45815766 GGGCCTGAAGGGGAGCGTGGAGG - Intronic
1168722238 19:58560499-58560521 GGGTGTGGAGGGGAGCATGCAGG + Intergenic
925468744 2:4135961-4135983 GGGCCTGCAGGTGGGCATGTGGG - Intergenic
927726461 2:25427576-25427598 GGCCCTGCAGGAGAGCAGGCGGG - Exonic
927780689 2:25937433-25937455 GGGTCTGCAGCTGAGCTTACAGG + Intronic
927904606 2:26847909-26847931 GGCCCTGCAGCAGGGCCTGCCGG + Intronic
929789271 2:45011647-45011669 GGGGCTGCAGAGGAGCACCCTGG + Intergenic
934712866 2:96527309-96527331 GGTCCGGCAGCAGAGCCTGCGGG + Intergenic
934754671 2:96816733-96816755 AGGCCTGCAGCTGAGCGCGCTGG + Exonic
938379075 2:130826513-130826535 GGACCTGCTGCTGACCATGCGGG - Intergenic
940641610 2:156350344-156350366 CAGCCTGCAGAGGAGCATGGAGG + Intergenic
943033813 2:182716231-182716253 GGGCCTGGCGCGGAGCATTGTGG - Intronic
945950229 2:216032537-216032559 GGGCCTGCAGAGCAGAATCCAGG + Intronic
947731810 2:232435414-232435436 GGGACTTCAGAGGAGCCTGCGGG - Intergenic
947749218 2:232524067-232524089 GGGCCTGCTGCGGAACGCGCAGG + Exonic
947767527 2:232647223-232647245 GGGCCTGGAGTGGAGAAAGCAGG + Intronic
948262345 2:236613531-236613553 GGGTGTGCATGGGAGCATGCAGG + Intergenic
948395465 2:237642190-237642212 GGGCCTTCAGGGAATCATGCTGG + Intronic
948975225 2:241459696-241459718 TGGCCTGCAGCCCAGCTTGCTGG + Intronic
948983487 2:241507039-241507061 GGGCCTGCAGTGGAACAGGAAGG - Intronic
1169282271 20:4278000-4278022 GGGCCTGCAGGGCAGGAGGCTGG + Intergenic
1169965907 20:11217142-11217164 AGGCCTGCAGGTGAGGATGCTGG + Intergenic
1170814298 20:19699705-19699727 AGGCCTGCAGCTGACCACGCTGG - Intronic
1170957805 20:20997432-20997454 GGACATGCAGGGGACCATGCAGG - Intergenic
1173047736 20:39528594-39528616 GGACCTGCAGCGGAGCATATGGG - Intergenic
1173852708 20:46228788-46228810 GGGCCAGCAGGGCTGCATGCTGG + Intronic
1174340773 20:49893591-49893613 GGACCTGCAGGAGAGCAGGCAGG + Intergenic
1174591002 20:51644994-51645016 GGGTCTGTAGCTGGGCATGCTGG - Intronic
1175980352 20:62735651-62735673 CGGCCTCCAGGGGAGCATGGGGG - Intronic
1176120343 20:63451752-63451774 GGGGCTGCAGGGGGCCATGCTGG - Intronic
1176144743 20:63560538-63560560 GGGCCACGAGCGGAGCCTGCTGG - Exonic
1176170889 20:63695963-63695985 AGGCCTGCAGCGGGCCAAGCCGG - Exonic
1176214014 20:63939715-63939737 GGTCCTGCAGGGGAGAAGGCAGG + Intergenic
1176240068 20:64071816-64071838 CCGTCTGCAGCGGAGCATGGAGG + Intronic
1178365333 21:31985360-31985382 AGGGCTGCAGTGGAGCATGGTGG + Intronic
1178726937 21:35061636-35061658 GGGCTTGAATCGGATCATGCAGG + Intronic
1181078069 22:20394509-20394531 GGGCCTGCAGCGGAGCCCCGCGG - Intronic
1182361352 22:29748258-29748280 GGGCCCTCAGAGGAGCAGGCTGG - Intronic
1182776964 22:32838403-32838425 GGGCCTGCAGAGGAGTCAGCAGG + Intronic
1183654309 22:39176145-39176167 GGTGCTGCTGCGGAGGATGCAGG - Intergenic
1183709725 22:39495793-39495815 GGGCCTGCTGTGAGGCATGCTGG - Intergenic
1183942272 22:41302344-41302366 GGGCCTGCAGCCGGGCCCGCGGG + Intronic
1184045748 22:41971375-41971397 TGACCAGCAGCTGAGCATGCCGG - Intergenic
1184296671 22:43529408-43529430 GAGCCTGGAGCAGAGCCTGCTGG + Intronic
1185177220 22:49334821-49334843 GGGCCTGCACGGGAGGATCCTGG - Intergenic
1185207052 22:49545912-49545934 GGGCCAGCAGAGGAGCCTGCAGG - Intronic
1185338434 22:50281113-50281135 GGGCCTGGAGGAGAGCGTGCGGG - Exonic
951717480 3:25664602-25664624 CGGCCTGCAGCGGCGCCCGCGGG - Intronic
954035024 3:47846800-47846822 GGGCCTGCAGCGGCTCAACCCGG + Exonic
963123802 3:141797326-141797348 CGGCCTGGGGCCGAGCATGCGGG + Intronic
965003493 3:162987372-162987394 GGGGCTGCAGGGGTGCTTGCCGG + Intergenic
967781460 3:193444902-193444924 GGGCCTGCTGTGGAGCATGGAGG - Intronic
968603830 4:1522277-1522299 GGGCTTGCAGGGGAGCCTGGTGG - Intergenic
968741636 4:2334408-2334430 GGGCCAGCGGCGGGGCCTGCAGG - Intronic
969048536 4:4356347-4356369 GAGCCTGCCGTGGAGGATGCTGG + Intronic
969354962 4:6619920-6619942 GCGCCTGCAGCACAGCCTGCAGG - Exonic
969451518 4:7276560-7276582 GGGCCTGGAGCGGGGGAGGCAGG - Intronic
969608407 4:8213608-8213630 GGGCCTTCAGCGGGACATGGTGG + Intronic
969673482 4:8602270-8602292 AGGACTGCTGCGGATCATGCAGG - Intronic
979865250 4:125745243-125745265 GGACCTGCAGCCGGCCATGCCGG + Intergenic
980388836 4:132119874-132119896 GGGCCTGGAGAGGAGCAGCCTGG - Intergenic
981275844 4:142897748-142897770 GGACCTGCAGCTCACCATGCCGG + Intergenic
985357198 4:189134125-189134147 GGGGCTGCAGCGGAACCTGGTGG - Intergenic
985552764 5:541705-541727 GGGCCTGGGGCGGGGCATGGGGG + Intergenic
985629810 5:1008629-1008651 GGTGCTGCAGCGGAGCCTGGCGG - Intergenic
991964885 5:72080961-72080983 GGGCCTGCTGTGGAGGATTCTGG - Intergenic
992048892 5:72925743-72925765 GGACCTGCAGCCCACCATGCCGG + Intergenic
992320879 5:75611969-75611991 GGGAGTGCAGCGGTGCAGGCTGG - Intronic
992678966 5:79134115-79134137 GGGACTGCAGGAGAGCAGGCAGG + Intronic
995975838 5:118034028-118034050 GGACCTGCAGCCCACCATGCCGG + Intergenic
999307307 5:150528061-150528083 TGGCGTGCAGTGCAGCATGCAGG - Exonic
1000312743 5:160061117-160061139 GGGGCTGAAGCGGGGCAGGCAGG - Intronic
1002101083 5:176857975-176857997 GGGCCTGCAGGACAGCAGGCAGG - Intronic
1006419471 6:33924286-33924308 GGGCAAGAAGAGGAGCATGCTGG - Intergenic
1006630581 6:35427328-35427350 GGGCCTGCAGGTGAGCAGGCAGG + Exonic
1007844060 6:44739389-44739411 GGGCCTGCTGAGGAGCCAGCAGG + Intergenic
1008520905 6:52362023-52362045 CGGGCTGCAGCGGAGCGCGCGGG + Intronic
1011515057 6:88144822-88144844 AGGCCTGCAGCGGAGGCTGCGGG + Exonic
1013957269 6:115855447-115855469 GGACCTGCAGCCGGTCATGCCGG + Intergenic
1019569480 7:1704177-1704199 GAGCCTGCAGCCGGGCATGGTGG + Intronic
1019623414 7:2003453-2003475 GGGCCTGTAGGGGAGCTTGGGGG - Intronic
1019729359 7:2622015-2622037 GGGGCTGCAGCTGAGCAGGTGGG + Intergenic
1019732388 7:2635148-2635170 GGCCCTGCAGCTGAGCTGGCAGG + Intronic
1020148643 7:5664716-5664738 GGGAGTGCAGAGGAGAATGCTGG - Intronic
1023174135 7:37419048-37419070 GAGCCCGCAGAGGAGGATGCTGG + Intronic
1023908298 7:44537152-44537174 GGGCCTGCAGGAGATCTTGCTGG - Intronic
1024199083 7:47088401-47088423 AGGCCAGCAGCTCAGCATGCCGG + Intergenic
1024200417 7:47101097-47101119 GGGCCTGCAGTGGTGGAAGCAGG + Intergenic
1026894269 7:74000863-74000885 GGGGCTGCAGGGGAGGACGCTGG + Intergenic
1029126344 7:98297402-98297424 TGGGCTGCAGCAGAGAATGCTGG + Intronic
1033341876 7:140498471-140498493 GGGACTGCAGCAGTGCATTCTGG + Intergenic
1033607201 7:142936231-142936253 GGGCCGGCAGGGGAGGAGGCTGG + Intergenic
1034274797 7:149819400-149819422 GGGCCAGCAGCGCCGCCTGCGGG + Intergenic
1035440340 7:158891955-158891977 GGACCTGGAGCGGAGCTTGATGG + Intronic
1037418177 8:18673852-18673874 GGGCGGGCAGGGGGGCATGCTGG + Intronic
1037596465 8:20358386-20358408 GGGCCTTCAGGGAAGCCTGCTGG + Intergenic
1039422354 8:37453736-37453758 GAGCCAGCAGTGGAGGATGCAGG - Intergenic
1040307453 8:46219555-46219577 GGGACAGCAGGGGAGGATGCTGG + Intergenic
1046611122 8:116426678-116426700 GTGCCTACAGGGAAGCATGCAGG - Intergenic
1049260771 8:141637919-141637941 GGGCCTGGGGTGGAGCACGCAGG + Intergenic
1049358567 8:142200869-142200891 GGGGCTGCAGTGAAGCATGATGG + Intergenic
1049442183 8:142614586-142614608 GGGCCTGCAGGGGCGCGGGCGGG - Intergenic
1049682465 8:143925734-143925756 GGAGCTGCAGCAGCGCATGCAGG - Exonic
1049944486 9:580880-580902 GGACCTGCAGCCCACCATGCCGG - Intronic
1052901574 9:33798511-33798533 GGGTCAGCACCGGAGCATCCAGG - Exonic
1057550723 9:96049489-96049511 CAGCCTGGAGCGGAGCAGGCCGG + Intergenic
1059204067 9:112446745-112446767 AGTCCTGCAGTGGAGCATCCTGG - Intronic
1060017417 9:120098718-120098740 GAGCCTCCAGGGGAGCATGGGGG + Intergenic
1060108829 9:120891982-120892004 AGGCCTCCAGGGGACCATGCGGG + Intronic
1061608915 9:131733214-131733236 GGGCCTGCAGTCACGCATGCGGG + Intronic
1061765399 9:132878343-132878365 GGGCCCGGCGCGGAGCCTGCAGG - Exonic
1062164964 9:135103077-135103099 GCCCCTCCAGCTGAGCATGCTGG + Intronic
1062316798 9:135971402-135971424 GGGCCTGGGGTGGAGGATGCTGG + Intergenic
1203780569 EBV:98424-98446 GGAGCTGCACCGGAGCCTGCCGG + Intergenic
1185643456 X:1600781-1600803 GGGCCTGCAGCGGAAAGAGCGGG + Exonic
1187259234 X:17669898-17669920 GGGCCTGGAGCAGAGCATTCAGG - Intronic
1189222143 X:39381686-39381708 GGGCCAGCAGCTGAGCAAGGAGG + Intergenic
1189274918 X:39778672-39778694 TGGGCTGCTGCGGGGCATGCTGG - Intergenic
1198138960 X:133783494-133783516 TGGCCTGCAGCTGAGCAAGAAGG + Intronic
1198210298 X:134509928-134509950 GGGCCTGCTGGGGAGCCAGCAGG - Intronic
1200108565 X:153727269-153727291 GGCCCTGCAGCCCAGCATGCGGG - Intronic