ID: 1146445310

View in Genome Browser
Species Human (GRCh38)
Location 17:32928158-32928180
Sequence GCGCGGGCGCGGGCCTGCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 310}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146445310_1146445317 -3 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445317 17:32928178-32928200 CGCCCGGACTTTGCCATCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
1146445310_1146445323 9 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445323 17:32928190-32928212 GCCATCGGCGGGGCAGTCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1146445310_1146445325 19 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445325 17:32928200-32928222 GGGCAGTCGCGGGATGCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 84
1146445310_1146445316 -6 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445310_1146445318 -2 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445318 17:32928179-32928201 GCCCGGACTTTGCCATCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1146445310_1146445322 8 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445322 17:32928189-32928211 TGCCATCGGCGGGGCAGTCGCGG 0: 1
1: 0
2: 1
3: 4
4: 44
1146445310_1146445326 20 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445326 17:32928201-32928223 GGCAGTCGCGGGATGCGCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1146445310_1146445320 -1 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445320 17:32928180-32928202 CCCGGACTTTGCCATCGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146445310 Original CRISPR GCGCGGGCGCGGGCCTGCAG CGG (reversed) Exonic
900589967 1:3455065-3455087 GAGCGGGCGGGGGCAAGCAGGGG - Intronic
901808328 1:11751473-11751495 GAGCGGGCTTGGGGCTGCAGTGG + Intronic
901837632 1:11934637-11934659 GCGCGGGGGAGGGCGTGGAGGGG + Intronic
902585740 1:17437965-17437987 GCGCGCGCCCGGGCCCGCGGCGG - Intronic
903413850 1:23168340-23168362 GAGGGGGCGCGGGCCGACAGGGG - Intronic
903462785 1:23530943-23530965 GCTCGGCCGCGGGCCAGGAGGGG - Exonic
903522251 1:23959677-23959699 GCGCGGAGGTGGGGCTGCAGAGG - Intronic
907222977 1:52921105-52921127 GGGCGGGCGCGCGGCTGGAGAGG + Intronic
907223127 1:52921615-52921637 GCGCAGCCGCGGGCCCGAAGGGG + Exonic
910251474 1:85201820-85201842 GCGCGGGCCGGGGGCGGCAGAGG + Intergenic
910759104 1:90718015-90718037 GCGGGGGCGCGGGCCCGGCGCGG - Intergenic
913972442 1:143424659-143424681 GCGCGGGCGCAGGCGCCCAGAGG - Intergenic
914066824 1:144250272-144250294 GCGCGGGCGCAGGCGCCCAGAGG - Intergenic
914112329 1:144716082-144716104 GCGCGGGCGCAGGCGCCCAGAGG + Intergenic
914869092 1:151458705-151458727 GCGCGGGCGGTGGCCCGCTGGGG - Intronic
915325840 1:155080791-155080813 GTGCGGGCCTGGGCCGGCAGAGG + Intronic
915722166 1:157993549-157993571 GGGCGGGCGCGGGCGGGCGGGGG + Intronic
916819828 1:168387305-168387327 GCGCGGCCGCGTGGCTGCGGAGG + Intergenic
917141631 1:171841455-171841477 GCGCCTGCGCGGGCGGGCAGGGG - Intergenic
919929920 1:202214424-202214446 GCGCGGGCAGGGGCGGGCAGGGG + Intronic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
923775832 1:236977729-236977751 GAGCGGGCACAGGACTGCAGAGG - Intergenic
924732414 1:246724257-246724279 GCGTGGGCGCGGCCCTGGCGCGG + Exonic
1063369205 10:5509903-5509925 GCACGGGCAGGGGCCTGCGGAGG + Intergenic
1063695656 10:8332673-8332695 GCGCGGGGCCGGGGCTGCAGTGG - Intergenic
1064478795 10:15719693-15719715 GCGCGGCCGCGGCGCAGCAGAGG + Exonic
1067098367 10:43317080-43317102 GCTGGGGCTCTGGCCTGCAGAGG - Intergenic
1067769902 10:49115551-49115573 GCGCGAGCGCGGGCCCGGGGCGG - Intergenic
1067806202 10:49395228-49395250 GAGCTGGAGCGGGCCTGGAGTGG + Intronic
1069024150 10:63521688-63521710 GCCCGGCCTCGGGCCTGCCGAGG + Intronic
1069557795 10:69408893-69408915 GCGGGGGCGGGGGCCTGGAGGGG - Intronic
1069761830 10:70816315-70816337 GGGCGGGCGCGGGGCCGCGGTGG + Intronic
1076367793 10:129933608-129933630 GCACGGGCACCCGCCTGCAGAGG - Intronic
1076799358 10:132813524-132813546 GTGCAGGGGCGGGGCTGCAGGGG - Intronic
1076799368 10:132813554-132813576 GTGCAGGGGCGGGGCTGCAGGGG - Intronic
1076799378 10:132813584-132813606 GTGCAGGGGCGGGGCTGCAGGGG - Intronic
1076799388 10:132813614-132813636 GTGCAGGGGCGGGGCTGCAGGGG - Intronic
1076799398 10:132813644-132813666 GTGCAGGGGCGGGGCTGCAGGGG - Intronic
1076799408 10:132813674-132813696 GTGCAGGGGCGGGGCTGCAGGGG - Intronic
1076825438 10:132964913-132964935 GCGCTGGCGCGGACCTGCCCCGG - Intergenic
1076895349 10:133308785-133308807 ACGCGGGCGCGGGCGTGATGAGG - Exonic
1076977896 11:189460-189482 GCGCGGGCGCCGGCGCACAGTGG + Intronic
1077008458 11:369742-369764 GCGGGGGCCGGGGGCTGCAGCGG + Intergenic
1077341321 11:2027652-2027674 GCCCGGGGCCGGGCTTGCAGGGG + Intergenic
1078087716 11:8244112-8244134 CCGTGGCCTCGGGCCTGCAGGGG + Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1081549101 11:44095895-44095917 GCGAGGGCTCGGGCCTCCGGGGG + Intronic
1081854570 11:46295527-46295549 GCACTGGCTCGGGCCTGCATGGG - Intronic
1081872919 11:46391471-46391493 GGGCGAGCGCGGGCCGGGAGCGG - Intergenic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083264086 11:61538115-61538137 GCACAGGCGAGGGCCTGCGGCGG - Intronic
1083342523 11:61967766-61967788 GAGCGCGCGAGGGCCTCCAGCGG - Intergenic
1083572626 11:63768556-63768578 GGGCGGCCCCGGGCCAGCAGTGG - Exonic
1083655913 11:64229602-64229624 GCCAGGGCTGGGGCCTGCAGAGG + Intronic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1084695906 11:70755550-70755572 GCCCCGGCCCCGGCCTGCAGTGG + Intronic
1085054177 11:73394468-73394490 GCGCTGGCGGCAGCCTGCAGGGG - Exonic
1087141439 11:94768887-94768909 GCGCGGGCGCGGGCGCGCCTCGG - Intronic
1091154654 11:133361731-133361753 GAGCGGCTGCGGGCCTGCAGGGG - Intronic
1202824306 11_KI270721v1_random:82841-82863 GCCCGGGGCCGGGCTTGCAGGGG + Intergenic
1091460924 12:643004-643026 GCGCGGGCGCCGGGCGGAAGAGG - Intronic
1098029014 12:66235309-66235331 GCGCGGGCGCGGGGCAGCCTGGG + Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101750847 12:107581315-107581337 GGGCGGGCGGGGGGCGGCAGGGG + Intronic
1102375791 12:112419536-112419558 GCGCGGGGCCGGGCCCCCAGTGG + Intronic
1103270221 12:119667735-119667757 GCGCTGCCGAGGGCCGGCAGGGG - Exonic
1104031011 12:125065729-125065751 GCGCGCGGCCGGGCCTGCGGGGG + Intronic
1104914522 12:132257873-132257895 GTGCGGGCTCGGCCCTGCGGAGG + Intronic
1105578659 13:21674524-21674546 GCGGGGGCGCACGGCTGCAGGGG + Intronic
1105926916 13:25017333-25017355 GCGCGGGCGCAGGCGCGGAGAGG + Intergenic
1106340268 13:28820321-28820343 GCGCGGGCGTGGGCGGGCAGAGG + Intergenic
1107830887 13:44373404-44373426 GCGCGGGCCCGGGCCTGGACTGG + Intergenic
1107935334 13:45341289-45341311 GCGCGGGGGCGGGGCCACAGCGG + Exonic
1114648924 14:24271064-24271086 GTGAGGGCGCGGGCCTGCGGAGG + Intronic
1116945281 14:50830717-50830739 GGGCGGGGGCGGGCCGGCGGGGG - Intronic
1117302165 14:54440918-54440940 GCAGGGCCGCGGGCCGGCAGAGG + Intronic
1118320376 14:64749104-64749126 GCGCGGGCGAGGGCATGGAGGGG + Exonic
1119325783 14:73759059-73759081 GCGGCGGCGCGGGCGTGCGGGGG + Intronic
1120302070 14:82720742-82720764 GAGCGGGTGTGGGTCTGCAGTGG + Intergenic
1121127545 14:91417776-91417798 CAGCGGGCGCGGGGCTGCGGCGG + Exonic
1121273364 14:92652089-92652111 GAGGGGGCCCAGGCCTGCAGTGG - Exonic
1121616991 14:95319925-95319947 GCGCGGGCGCGGGCGGGGCGGGG + Intergenic
1122130859 14:99604042-99604064 GCGCGGGCGGGGGGCGGCCGGGG + Intergenic
1122220968 14:100239031-100239053 GCGCGGGCGCGGGCGCACCGAGG + Exonic
1122719895 14:103716090-103716112 GCGGGGGCGGGGGCCGGCTGGGG - Intronic
1122975104 14:105167809-105167831 GCGCGGGCGCGGGCCCGGGCCGG - Exonic
1124109531 15:26773156-26773178 GCGCGGGCGCGGGGCGGGGGAGG + Intronic
1124142295 15:27088271-27088293 GGGCGGGCGCGGGCCAGGAGTGG + Intronic
1125674167 15:41493801-41493823 GGCGGGGCGCGGGCGTGCAGCGG + Intronic
1126738033 15:51751550-51751572 GCCGGGGCGCGCGGCTGCAGCGG - Exonic
1127752589 15:62060462-62060484 GCGCGGGGGTGGGCCTGCGCCGG - Intronic
1129108263 15:73323289-73323311 GAGCGGGCGCCTGGCTGCAGCGG + Exonic
1131272847 15:90957349-90957371 GCACGGGCGCAGGGCAGCAGGGG - Exonic
1131475395 15:92734244-92734266 GCGGCGGCGCGGGTCGGCAGCGG - Intronic
1132695938 16:1202055-1202077 GCTCGGGGCCGGGCCTGCGGGGG - Exonic
1133029622 16:3004274-3004296 GCGCGGGCGCGGGCGAGCCGCGG - Intergenic
1133634726 16:7654078-7654100 GCCCGGCCGCGCACCTGCAGTGG + Intronic
1133784445 16:8963625-8963647 GCGGGGCCGCGGGCCGGCCGGGG + Intronic
1134974808 16:18562008-18562030 GCCAGGGCGCGGGGCTGCTGGGG - Exonic
1135324913 16:21520222-21520244 GCGAGGGCGTGACCCTGCAGGGG - Intergenic
1136336400 16:29613497-29613519 GCGAGGGCGTGACCCTGCAGCGG - Intergenic
1136634095 16:31508272-31508294 CCGCGGACGGGAGCCTGCAGTGG - Exonic
1136778995 16:32885594-32885616 CCGAGGGCGCGGGCCGGCCGGGG + Intergenic
1136891623 16:33975924-33975946 CCGAGGGCGCGGGCCGGCCGGGG - Intergenic
1136927477 16:34388487-34388509 GACCGGGCGCGGGCCTGCGGAGG + Intergenic
1136977097 16:35023319-35023341 GACCGGGCGCGGGCCTGCGGAGG - Exonic
1139491118 16:67286538-67286560 GAGCTGGCACGGGCCTGCGGGGG + Exonic
1141231328 16:82170300-82170322 GCGCGGGCGCGGCCACTCAGCGG + Intergenic
1141443281 16:84042854-84042876 CCCCGGGGCCGGGCCTGCAGGGG - Intergenic
1141727472 16:85799408-85799430 GCGCGGCCGCGGGCTGGCGGGGG + Exonic
1141831097 16:86510367-86510389 GCGCGGGGGCGGGCGCGCCGCGG + Intergenic
1142037120 16:87869279-87869301 GCGAGGGCGTGACCCTGCAGCGG - Exonic
1203081406 16_KI270728v1_random:1147683-1147705 CCGAGGGCGCGGGCCGGCCGGGG + Intergenic
1142465318 17:133925-133947 GCGCGGGCGCCGGCGCACAGTGG + Intergenic
1143390508 17:6556670-6556692 GCGGGGGTGCGGGCCCGCGGGGG - Intergenic
1143962142 17:10729820-10729842 GCGCTGTGGCGGGCCTGCAACGG - Exonic
1144109967 17:12021355-12021377 GCGCCGGCTCGGGGCTGCGGCGG + Intronic
1144599561 17:16600306-16600328 GGGCGGGGGCAGGCCTGCAAGGG - Intergenic
1144742466 17:17591660-17591682 CCGGGGGCGCGTGGCTGCAGCGG - Exonic
1144847045 17:18225550-18225572 GCGCGGGGCCGGGCCTGCACGGG - Intergenic
1146283226 17:31558826-31558848 GCGGGGGCGCGGCCCGGGAGCGG + Intergenic
1146445310 17:32928158-32928180 GCGCGGGCGCGGGCCTGCAGCGG - Exonic
1147044715 17:37744144-37744166 GCGCGGCCTGGGGCTTGCAGCGG + Intronic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147710316 17:42458826-42458848 GCGGGGGCGGGGGCCGGCGGCGG + Intronic
1148122762 17:45222280-45222302 GCGCGGGCGGGGGGCGGCAGGGG + Intronic
1151296901 17:73192807-73192829 GGGCGGGCGCGGTCCTGCGCGGG - Intronic
1151370891 17:73645401-73645423 GCGCGGCCGCGGGCGCCCAGCGG + Intergenic
1151668630 17:75559389-75559411 GCTCGGACGCGGTGCTGCAGCGG + Exonic
1151743656 17:76000603-76000625 GCGCCGGCGGGGGCCAGGAGGGG + Intronic
1152542100 17:80981647-80981669 GTGGGGGCGCTGGGCTGCAGGGG - Intergenic
1152628851 17:81400579-81400601 GCGCGGGCGCGGGCTGGGGGTGG + Intronic
1152970622 18:158339-158361 GCGCAGGCGCGCACCTGCTGCGG + Intergenic
1153872545 18:9334508-9334530 GGGCGGGCGGGAGCCTGCGGTGG + Intergenic
1153900661 18:9614628-9614650 CCGAGGGCCCGGGCCTGCCGCGG + Intronic
1160204516 18:76822321-76822343 GCGCGGGCGCGGGCGCGGTGGGG - Intergenic
1160710447 19:548851-548873 GCGGGGGCGGGGGGCGGCAGCGG - Intronic
1160715045 19:572720-572742 GCGGGGGTGCGGTCCTGCAGGGG + Intronic
1160807028 19:996430-996452 GTGCGGGAGCGGGCGTGGAGAGG - Intronic
1160824897 19:1074897-1074919 GGGCGGGCGGGGGCGGGCAGCGG + Intronic
1160976839 19:1796889-1796911 GCGGGGGCACGGGCCGGCTGTGG + Intronic
1161072793 19:2270872-2270894 GGGAGGGCCCGGGCCTGGAGCGG + Intronic
1161291613 19:3496735-3496757 GCCCGGAAGCGGGCCTGCAGGGG + Exonic
1161461559 19:4400567-4400589 GCGCGCGCGGGGGCCGGCACCGG - Intergenic
1162046771 19:8005395-8005417 GGGCGCCCGCGGGCCTGCACCGG - Intronic
1162480021 19:10922452-10922474 GGGCGGGGGGGGACCTGCAGGGG - Exonic
1162575288 19:11495627-11495649 GGGCGGGGGCAGGCCTGCTGGGG - Intronic
1162951376 19:14073656-14073678 GGGACGGCGCGGGCCCGCAGAGG + Exonic
1163617893 19:18340601-18340623 GCGCGGCCGAGAGGCTGCAGCGG + Exonic
1163636014 19:18437523-18437545 GCGGGGGCGGGAGCCTGCAGGGG - Intronic
1163714644 19:18866689-18866711 TCGCCGCCGCGGGCCAGCAGGGG - Exonic
1164648138 19:29873750-29873772 GCGCGGGCGCGGGGGCGCGGGGG - Intergenic
1164958272 19:32405529-32405551 GCGCGGCCGCGGAGCTGCAGTGG - Intronic
1165349384 19:35268087-35268109 GCGCGGGCGCGGGCCGGGCCAGG - Intergenic
1166139679 19:40799347-40799369 GCGCGCGCCGGGGCCTGCCGGGG + Intronic
1166375850 19:42326316-42326338 GCCCGGGCGGGGGACTGCAAGGG + Exonic
1166660442 19:44643780-44643802 GAGCGAGCGCGCGTCTGCAGCGG + Exonic
1167437191 19:49486342-49486364 GCGCCGGCCCGGGGCTCCAGGGG - Intergenic
1167466149 19:49651915-49651937 GCGCGTGGGCGGACCAGCAGCGG - Exonic
1167501511 19:49851227-49851249 GCGCGGGCGCGCGGCTTCGGGGG - Exonic
1168414506 19:56159913-56159935 GCGCGGGCCCGGGGCTGCCGGGG - Exonic
927513091 2:23656756-23656778 GCACGGGGTGGGGCCTGCAGAGG + Intronic
927667455 2:25042336-25042358 GCCCGGGCCCGGGCCCGCGGGGG + Intronic
929151149 2:38750517-38750539 GGGAGCGCGCGGGCCCGCAGCGG + Intronic
929501423 2:42494101-42494123 GTGCGGGCGCGGGCGGGAAGCGG - Intergenic
931978687 2:67670836-67670858 AGGCAGGCGCGGTCCTGCAGAGG + Intergenic
932763780 2:74457695-74457717 GCGCGGCGGCGGGCCTGAGGGGG - Exonic
934709993 2:96508495-96508517 GAGTGGGCGCGGGGCAGCAGTGG - Intergenic
938262644 2:129906505-129906527 GCCAGGGCGCTGGGCTGCAGAGG + Intergenic
938397766 2:130963640-130963662 GCGCGCACGCAGGCCTGGAGCGG - Intronic
946175332 2:217918996-217919018 GCTCGGGCTCAGGCCTGCTGGGG - Intronic
946370581 2:219279308-219279330 GGGGGGGTGGGGGCCTGCAGGGG - Exonic
947119236 2:226799129-226799151 GCGCGCGCGCGCTCCTGGAGGGG - Exonic
947815188 2:233032096-233032118 GCGAGGGGGCGGCGCTGCAGTGG - Intergenic
948393275 2:237627432-237627454 GCGCGGGCCAGGGACTGCAGGGG - Intergenic
948466863 2:238156473-238156495 GAGCCGGCGTGGGGCTGCAGAGG - Intergenic
948930047 2:241126254-241126276 GCGGGGCTGCTGGCCTGCAGCGG - Exonic
949004404 2:241637173-241637195 GGGCGGGGGCGGGCCCGCTGCGG - Exonic
1169118651 20:3082902-3082924 GGGGGGACGCGGGCCTGCGGCGG - Intronic
1169130563 20:3164543-3164565 GCGGGAGCGCGGGGCCGCAGGGG - Exonic
1169164127 20:3407702-3407724 GCGGGGGCGGGGGCGTGGAGGGG + Intergenic
1171225119 20:23436288-23436310 GCGAGGGCTCAGGGCTGCAGTGG + Intergenic
1172618621 20:36306197-36306219 CCGCGGGCGCGGGGCTGGGGGGG - Intergenic
1173164510 20:40677182-40677204 GCGCTGGGGTGGGACTGCAGGGG - Intergenic
1173165955 20:40687696-40687718 GCGGGTGCGCGGGCGGGCAGGGG - Exonic
1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG + Intergenic
1174467867 20:50731432-50731454 GCGCGCGCGCGGGCTCGCGGGGG + Intergenic
1174607102 20:51768690-51768712 GCGCGGGCGCGGGCCGGGGGCGG - Intergenic
1175912459 20:62411314-62411336 GCCCGGGGGCAGGCCTGCTGAGG - Intronic
1175926541 20:62474231-62474253 GCGCCGGGCCGGGCCTGGAGGGG - Intronic
1176085601 20:63294171-63294193 GCGGGGGAGGGGGCGTGCAGGGG + Intronic
1176148040 20:63574133-63574155 GCGGGGGCGCGGGGGTCCAGGGG - Intronic
1176242401 20:64081125-64081147 GCGGGGGCGGGGGCCCGAAGGGG + Intronic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1180791342 22:18577219-18577241 GGGCAGGGGCGGGCCTGGAGGGG - Intergenic
1180831094 22:18906496-18906518 GGGCGGGCGGCGGCCTGCCGAGG + Intronic
1181068747 22:20319845-20319867 GGGCGGGCGGAGGCCTGCGGAGG - Intronic
1181094468 22:20495952-20495974 GCGCGGGGGCGGCCCTGGGGCGG + Intronic
1181230395 22:21418092-21418114 GGGCAGGGGCGGGCCTGGAGGGG + Intronic
1181248254 22:21516774-21516796 GGGCAGGGGCGGGCCTGGAGGGG - Intergenic
1181514367 22:23402675-23402697 GCGCGGGCGCGGGCCCGGGCTGG + Intergenic
1182475527 22:30574602-30574624 GAGCGGGCGCGGCGCGGCAGCGG - Intergenic
1183370180 22:37427652-37427674 GGGCGGGAGCGGGCTTGCTGCGG - Intergenic
1183667401 22:39253713-39253735 GCGAGGGGCCGGGACTGCAGTGG + Intergenic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
1184035292 22:41915111-41915133 GCGCGGGCTCGGGCGGGCGGGGG + Intergenic
1185302540 22:50090029-50090051 GCGCGGGCGCGTGCGGGCGGCGG + Exonic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1203281181 22_KI270734v1_random:131767-131789 GGGCGGGCGGCGGCCTGCCGAGG + Intergenic
950729886 3:14947926-14947948 GGGCGGGCTCGGGCCGGCGGCGG + Intronic
951590481 3:24259060-24259082 GAGCAGGCGTGGGTCTGCAGTGG - Intronic
952942674 3:38455467-38455489 GGGCGGGGCCGGGCGTGCAGGGG + Intronic
953356848 3:42263526-42263548 CCGCGGGCTCCGGGCTGCAGCGG - Exonic
953638691 3:44685514-44685536 GAGCGGGCGCAGGCTTGCCGGGG - Intergenic
954437488 3:50503723-50503745 GCGCGGGGGCGGGCCAGCCCGGG - Intronic
954688089 3:52381472-52381494 GCTTGGGCTCGAGCCTGCAGGGG + Intronic
956681585 3:71785928-71785950 GAGCTGGCGCGGGGCTGAAGAGG - Intergenic
959085631 3:101849115-101849137 GCGCAGGGCTGGGCCTGCAGAGG - Intronic
959462502 3:106644105-106644127 GAGCGGGCGCGGGGGAGCAGGGG - Intergenic
961762767 3:129183781-129183803 GCGTCGGAGCGGGCCCGCAGCGG + Exonic
962222221 3:133573657-133573679 GCGCGCGCGCAGGCCTGGAGAGG - Intergenic
964358638 3:155871528-155871550 GCCCTCACGCGGGCCTGCAGGGG - Intronic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
966866463 3:184261307-184261329 GGGCGGGAGCGGGACTGCGGCGG + Exonic
967880353 3:194297246-194297268 GCGGGGGCCCGGGGCTGGAGGGG - Intergenic
968186958 3:196639629-196639651 GCGCGGGCGCGGGGGTGGGGCGG - Intergenic
968521249 4:1035766-1035788 GCCAGGGCCCGGCCCTGCAGAGG + Intergenic
968746874 4:2364919-2364941 GCGGGGGCGGGGCCCAGCAGGGG + Intronic
969288239 4:6221899-6221921 GGGCGGGCGCAGGCCTCCACTGG + Intergenic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
969394115 4:6909705-6909727 GAACGGGCGCGGGCCGGCAGGGG + Intronic
971000584 4:22317677-22317699 GCCCAGGCGCCGGACTGCAGTGG - Intergenic
973870077 4:55157710-55157732 GCGCGGGTCCGGGACTGCCGTGG - Intergenic
973945236 4:55948758-55948780 CCGCGGGCGCCGACCTCCAGGGG + Intergenic
974047343 4:56908602-56908624 GGGCCGGCGCGGGGCTGCGGTGG - Intronic
978776977 4:112514927-112514949 GCGGCGGCGGGGGCCTGCCGGGG - Exonic
982343719 4:154333067-154333089 GCCTGGGCGCGGGCGAGCAGCGG - Exonic
982384183 4:154781842-154781864 GCAGCGGCCCGGGCCTGCAGCGG - Intronic
983904409 4:173169143-173169165 GCGAGGGGGCGGGCCGGCGGCGG - Intronic
985595817 5:787392-787414 GCGCGGGTGCCGGGCAGCAGGGG - Intergenic
990825495 5:59893579-59893601 GCGCCGGCCCGGGCGGGCAGCGG - Exonic
992530138 5:77645307-77645329 GCGGCGGCGCGGGCCGGCTGGGG - Intergenic
993501578 5:88672884-88672906 GTGCGGGCGCGGGGCCGCGGCGG + Intergenic
993703434 5:91144053-91144075 CAGTGGGAGCGGGCCTGCAGGGG + Intronic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
999129448 5:149271799-149271821 GCGCGGGCGCGGGCGGGGCGGGG + Intergenic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1001065101 5:168529658-168529680 GCGCGGGCGCGCGGCTTCGGCGG + Exonic
1002046225 5:176543171-176543193 GGGCGGCCGCGGGCCGGCGGAGG - Intronic
1002176375 5:177403604-177403626 CCTCGGGTGCGGGCCTGCGGGGG + Exonic
1002185950 5:177454893-177454915 GCGCCGGCGGGGGACAGCAGCGG - Exonic
1002193799 5:177491775-177491797 GCGTGGGCGCGGGCGGGCAGGGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002527060 5:179820774-179820796 GCGCGAGAGCCGCCCTGCAGAGG - Exonic
1004396232 6:15248447-15248469 GCGGGGGCGTGGGCGTGCCGGGG + Intronic
1006137113 6:31901935-31901957 GCGCAGGCGCGGGGATGCACGGG + Exonic
1007161073 6:39792332-39792354 GCGCGAGGCCGGGCCTGGAGGGG + Intergenic
1007373736 6:41442960-41442982 GAGGGGGCGCCGGCCTGGAGAGG + Intergenic
1007557921 6:42782480-42782502 GCGGGGGCGCAGGCGGGCAGGGG + Intronic
1012245784 6:96924473-96924495 GCGGGGGCGGGGGGCGGCAGGGG + Intergenic
1015149258 6:130019952-130019974 GCGCGGGCGCGGGCGTGTGTCGG + Intronic
1015244517 6:131062534-131062556 GCGCGGACGCGAGCCTACAGCGG + Intronic
1015554958 6:134451732-134451754 GCAGGGGCCTGGGCCTGCAGGGG - Intergenic
1016340917 6:143060812-143060834 GCGCGGGCGCGGGCGCGGGGCGG - Intronic
1017502926 6:155042191-155042213 GGGCGGGGGCGGGTCTGCGGTGG - Intronic
1017671975 6:156777726-156777748 GCGCGGGCGCGGGCAGGCAGCGG + Intergenic
1018150248 6:160931067-160931089 GGGCGGCCGCGGGCCCGCTGCGG - Intergenic
1020771671 7:12403620-12403642 GCGCGGGGGTGGGCGCGCAGTGG - Intronic
1020796794 7:12686820-12686842 GCCCGGGCGCCGGCCTGTAGGGG - Intergenic
1021963549 7:25895530-25895552 GCGCCGGGGCGGGCCAGCAGGGG - Intergenic
1021992510 7:26152140-26152162 GCGCGGGCCCCGGGCGGCAGGGG + Intergenic
1022100995 7:27169167-27169189 GGGCAGGCGCAGGCCTCCAGTGG + Intronic
1023038462 7:36153073-36153095 GCGCAAGGGCGGGCCTGGAGTGG - Intergenic
1023791842 7:43758831-43758853 CCGCGGGCCCGGGCCTCCTGCGG - Intronic
1023951275 7:44848014-44848036 GCGGCGGCGCGGGTCGGCAGCGG - Exonic
1024085514 7:45888929-45888951 CCGCGGGTGAGGGCGTGCAGAGG - Exonic
1026000348 7:66556270-66556292 GCGCGGGCGCGGGCGCGAGGGGG - Intergenic
1026360430 7:69598047-69598069 GCGGGGGCGGGGGCGTGGAGGGG - Intergenic
1027390369 7:77697148-77697170 CCGCGTGCGCCGGCCTGGAGGGG + Intronic
1027540079 7:79454477-79454499 GCGCGGGCGGGGGCCTGCCCCGG - Intergenic
1029537690 7:101165718-101165740 GCGCAGGCGCAGGCCGGGAGAGG - Intergenic
1034284202 7:149873756-149873778 GTGCGGGCGCGGGGCTGACGCGG + Exonic
1034445927 7:151114507-151114529 GCGGGGGAGCCGGCCTGCTGGGG - Intronic
1035297549 7:157875851-157875873 GGGCAGGCACGGGGCTGCAGAGG + Intronic
1035297595 7:157875971-157875993 GGGCAGGCACGGGGCTGCAGAGG + Intronic
1035475962 7:159144593-159144615 GCGCGGGCGGGGTCCGGGAGAGG - Intronic
1035629869 8:1098808-1098830 GCGCGGCCGGGAGCCTGGAGTGG - Intergenic
1036311326 8:7686393-7686415 ACGCGGGCGCGGGGGTGCCGGGG - Intergenic
1038554120 8:28494558-28494580 GCGGGGGCCCGGGCCCGCGGTGG + Intronic
1038727663 8:30095610-30095632 GCGCGCGCGCGAGCCCGGAGGGG - Intronic
1041689885 8:60678650-60678672 GCGCGGGCGCGGGCGCGGCGCGG + Intergenic
1041689909 8:60678740-60678762 GCGCAGGCGCTGGCGTGCTGGGG + Intergenic
1042701937 8:71625136-71625158 GGGCGGGCACGGGCCTCCTGTGG - Intergenic
1043372852 8:79613044-79613066 GCCCGGGCGCGAGACCGCAGAGG + Intronic
1044138093 8:88611929-88611951 GCGCTGGAGCTGGCCTGCTGGGG - Intergenic
1045547440 8:103141071-103141093 GGGCGGGCGAGGGTCTGCAGGGG - Intronic
1046934584 8:119874021-119874043 GCGTGCGCGCAGGACTGCAGCGG - Intronic
1048330451 8:133467284-133467306 GGGCGGGCCTGGGCATGCAGCGG - Intronic
1049366355 8:142238730-142238752 GTGCAGGGGCGGGCGTGCAGGGG - Intronic
1049366365 8:142238758-142238780 GTGCAGGGGCGGGCGTGCAGGGG - Intronic
1049442187 8:142614596-142614618 GCGCAGGGCGGGGCCTGCAGGGG - Intergenic
1054258423 9:62838365-62838387 GCGCCGGCGCAGGCGTGGAGAGG - Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1056873551 9:90306341-90306363 CCGAGGGGGCGGGGCTGCAGCGG + Intergenic
1057207837 9:93184201-93184223 GCGGGAGCGCGGCCCCGCAGTGG + Intergenic
1057401373 9:94726552-94726574 GCGCAGGCGCGGAGCTGCCGCGG - Intergenic
1057786059 9:98087992-98088014 GGGCGTGCGCGCGTCTGCAGGGG + Exonic
1058884712 9:109314510-109314532 GGGCGGGGGTTGGCCTGCAGGGG - Intronic
1059769827 9:117414781-117414803 GCGGTGGCGCCGGCCAGCAGCGG + Exonic
1060812077 9:126615626-126615648 GCGCGGGCCGGGCCCGGCAGGGG - Intronic
1061286524 9:129626412-129626434 GCGTGCGCGCGGGCCGGCACAGG + Intronic
1061413490 9:130433238-130433260 GCGCGTGGGCGGAACTGCAGGGG + Intronic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062285407 9:135770535-135770557 GCCCTGGGGCGGGGCTGCAGAGG + Intronic
1062499414 9:136845865-136845887 GGGCGGGCGCCGGCCTTCGGGGG - Exonic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1186768145 X:12791758-12791780 GCGCGGGCGCGGGGGCGCGGAGG - Intronic
1189487136 X:41442618-41442640 GCGCCGCCGCGGTCCTGGAGGGG - Intergenic
1196443300 X:115732818-115732840 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196444222 X:115737119-115737141 GCCCCGGCGCCGGCCAGCAGCGG + Intergenic
1196445621 X:115844733-115844755 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196446292 X:115847714-115847736 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196446963 X:115850695-115850717 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196447632 X:115853678-115853700 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196448302 X:115856657-115856679 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196448971 X:115859648-115859670 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196449642 X:115862639-115862661 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196450311 X:115865622-115865644 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196450981 X:115868607-115868629 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196451652 X:115871586-115871608 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196452323 X:115874573-115874595 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196452993 X:115877542-115877564 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196453663 X:115880535-115880557 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196454332 X:115883544-115883566 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1196455412 X:115888616-115888638 GCCCCGGCGCCGGCCAGCAGCGG - Intergenic
1197445794 X:126551794-126551816 GTGCGGGCCCTGGCCTGCGGCGG - Exonic
1200092243 X:153641457-153641479 GCCCGGCCTCGTGCCTGCAGTGG - Intergenic
1200100810 X:153688460-153688482 CCGAGGGCGCGGGCCGGCCGGGG - Exonic
1200292586 X:154886723-154886745 GCGCTGGCGGCGGCCTGCAGCGG - Exonic
1200339430 X:155382463-155382485 GCGCTGGCGGCGGCCTGCAGCGG - Exonic
1200347040 X:155458230-155458252 GCGCTGGCGGCGGCCTGCAGCGG + Exonic