ID: 1146445316

View in Genome Browser
Species Human (GRCh38)
Location 17:32928175-32928197
Sequence CCGCGCCCGGACTTTGCCAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146445310_1146445316 -6 Left 1146445310 17:32928158-32928180 CCGCTGCAGGCCCGCGCCCGCGC 0: 1
1: 0
2: 1
3: 31
4: 310
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445308_1146445316 5 Left 1146445308 17:32928147-32928169 CCCGGCATGCTCCGCTGCAGGCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445309_1146445316 4 Left 1146445309 17:32928148-32928170 CCGGCATGCTCCGCTGCAGGCCC 0: 1
1: 0
2: 1
3: 13
4: 235
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445304_1146445316 23 Left 1146445304 17:32928129-32928151 CCTAGGGCCGCGGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1146445306_1146445316 16 Left 1146445306 17:32928136-32928158 CCGCGGCGCTTCCCGGCATGCTC 0: 1
1: 0
2: 1
3: 2
4: 84
Right 1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146445316 Original CRISPR CCGCGCCCGGACTTTGCCAT CGG Exonic
902284060 1:15395021-15395043 CCGCACCCAGCCTTTCCCATAGG - Intronic
911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG + Intronic
911261510 1:95691976-95691998 CCCCGCCCGTACTTTGAAATTGG + Intergenic
1064544812 10:16439471-16439493 CAGTGCCAGGACTTGGCCATAGG + Intronic
1072503744 10:96043925-96043947 TCACCCCCGGGCTTTGCCATGGG + Intronic
1077307674 11:1875260-1875282 CAGCGCCTGGACTTGGACATCGG - Intronic
1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG + Exonic
1083703847 11:64499736-64499758 CCGTGCCAGGCCTTTGCTATGGG - Intergenic
1084276152 11:68051954-68051976 CCCCGCCCTGGCTTTGACATGGG + Intergenic
1085212211 11:74791447-74791469 CAGTGCCCGGGCTGTGCCATGGG + Intronic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1119190000 14:72674776-72674798 CAGTGCCTGGACCTTGCCATTGG + Intronic
1121880186 14:97492939-97492961 CCAAGCCCAGACTTTGGCATAGG + Intergenic
1129287923 15:74540983-74541005 CTGTGTCCGCACTTTGCCATTGG + Intergenic
1134228177 16:12408308-12408330 CCAAGCCAGGACTTTTCCATAGG + Intronic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1147629150 17:41918879-41918901 CCGCGCACGGACTTCGGCAGAGG - Exonic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1168314085 19:55476549-55476571 CCGCCCCCGGACCCTCCCATTGG - Exonic
936002889 2:108851591-108851613 CCGCGCCCGGCCTTTCTCTTGGG + Intronic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG + Intronic
1176239190 20:64068053-64068075 CCGCTCCCTGGCTTTGGCATCGG - Exonic
962720962 3:138174564-138174586 CCGGGCCCGGACTTGGCGGTGGG - Intronic
966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG + Intergenic
970131462 4:12876170-12876192 CCCTGCCTGGACGTTGCCATGGG - Intergenic
974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG + Intergenic
998508665 5:142693220-142693242 CCGCGACAGGGCTTTGCCAAAGG - Intronic
999565499 5:152855875-152855897 CAGAGCCGGGACTTTGGCATTGG - Intergenic
1001704462 5:173731732-173731754 CCAAGCCAGGACTGTGCCATGGG - Intergenic
1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG + Intronic
1004296440 6:14416090-14416112 CCACTCCTGGACTGTGCCATAGG + Intergenic
1007975834 6:46100405-46100427 CAGCTCCCTGACTTTGCCCTGGG + Intergenic
1016990678 6:149925851-149925873 CCTCGCGGGGACTTTGCCACCGG + Intergenic
1022310879 7:29194823-29194845 CGTCCCCAGGACTTTGCCATGGG + Exonic
1023546796 7:41326036-41326058 CTGCGCCCGGCCTATGCCACTGG + Intergenic
1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG + Intergenic
1044611540 8:94096914-94096936 CCTCTCCCTGACATTGCCATGGG + Intergenic
1048459929 8:134613360-134613382 CCGCGTCCGGACTCTGCTTTAGG + Intronic
1060724683 9:125999152-125999174 CCGTGCCCCGCCTTTGCCTTCGG + Intergenic
1062338343 9:136082312-136082334 CAGAGCCCGGACTTGGCCTTGGG - Intronic
1190598649 X:52068675-52068697 CCCCGCCCGGACCTAGCCAAAGG - Intronic
1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG + Intronic
1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG + Intronic