ID: 1146445347

View in Genome Browser
Species Human (GRCh38)
Location 17:32928258-32928280
Sequence CGGGCGGGCCGCGGCGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146445329_1146445347 16 Left 1146445329 17:32928219-32928241 CCGGGAGCCACAGCCTGAGGTGG 0: 1
1: 0
2: 4
3: 54
4: 479
Right 1146445347 17:32928258-32928280 CGGGCGGGCCGCGGCGAGTCGGG 0: 1
1: 0
2: 2
3: 31
4: 278
1146445328_1146445347 17 Left 1146445328 17:32928218-32928240 CCCGGGAGCCACAGCCTGAGGTG 0: 2
1: 0
2: 2
3: 63
4: 1366
Right 1146445347 17:32928258-32928280 CGGGCGGGCCGCGGCGAGTCGGG 0: 1
1: 0
2: 2
3: 31
4: 278
1146445332_1146445347 9 Left 1146445332 17:32928226-32928248 CCACAGCCTGAGGTGGGTGAGCC 0: 1
1: 0
2: 2
3: 23
4: 316
Right 1146445347 17:32928258-32928280 CGGGCGGGCCGCGGCGAGTCGGG 0: 1
1: 0
2: 2
3: 31
4: 278
1146445333_1146445347 3 Left 1146445333 17:32928232-32928254 CCTGAGGTGGGTGAGCCCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1146445347 17:32928258-32928280 CGGGCGGGCCGCGGCGAGTCGGG 0: 1
1: 0
2: 2
3: 31
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146445347 Original CRISPR CGGGCGGGCCGCGGCGAGTC GGG Intronic