ID: 1146447561

View in Genome Browser
Species Human (GRCh38)
Location 17:32944466-32944488
Sequence GGGCACACAGAGAAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 1, 2: 5, 3: 67, 4: 590}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146447547_1146447561 26 Left 1146447547 17:32944417-32944439 CCATGACTGTAGCCAGTGCTGTG 0: 1
1: 0
2: 0
3: 15
4: 227
Right 1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG 0: 1
1: 1
2: 5
3: 67
4: 590
1146447552_1146447561 14 Left 1146447552 17:32944429-32944451 CCAGTGCTGTGATGGAGGGGACC 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG 0: 1
1: 1
2: 5
3: 67
4: 590
1146447557_1146447561 -7 Left 1146447557 17:32944450-32944472 CCACAAGAGGGACTGTGGGCACA 0: 1
1: 0
2: 1
3: 28
4: 248
Right 1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG 0: 1
1: 1
2: 5
3: 67
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146447561 Original CRISPR GGGCACACAGAGAAGGGACA GGG Intronic
900151756 1:1181980-1182002 GTGCACACAGAGCTGGGGCAGGG + Intronic
900193390 1:1361133-1361155 GGACACACAGAGAAGATACACGG + Intronic
900737330 1:4307365-4307387 GGGCAGACACAGAAGGGGCTTGG - Intergenic
900893826 1:5469174-5469196 GGGCACAAAGCCAGGGGACACGG + Intergenic
900917895 1:5651173-5651195 GGGCACACAGGGAAGGAGGAAGG + Intergenic
901151309 1:7104660-7104682 GAGCACACAGAGATGGGAGTGGG - Intronic
901158980 1:7160552-7160574 GGTCACAAAGAGAAGAGAGAAGG - Intronic
901840348 1:11950277-11950299 GGGCACAGACAGGAGGGACCAGG - Intronic
901847255 1:11991341-11991363 GGGCACACAGAGAAGGGGTCCGG + Intronic
901871966 1:12143421-12143443 GGGCCCACAGAGAGCGGTCAAGG - Exonic
903316879 1:22515034-22515056 GGGTACACAGTGAGAGGACAGGG + Intronic
903772150 1:25770724-25770746 GGGCAGACAGAGAGGGGAGAAGG - Intronic
903805642 1:26003863-26003885 GGGAACTCAGAGAAGGGATGAGG - Intergenic
904292787 1:29498419-29498441 GGGCAGACAGAGAAGGAGAAGGG + Intergenic
904633821 1:31864187-31864209 GGCCACACAGAGAAGCACCAGGG + Intergenic
904711658 1:32434682-32434704 GGTCCCACAGAGATGGGACATGG - Intergenic
905258520 1:36701078-36701100 GGGAACACAGAGGAAGGCCAGGG - Intergenic
905386609 1:37608765-37608787 GGGAACACAGAGATGGAAGATGG + Intergenic
906200049 1:43954185-43954207 TGGCACAAAGAGAAGGGGCAGGG - Intronic
906301051 1:44681915-44681937 TGGCGCACAGAGAAGAGACATGG - Intronic
907078069 1:51595870-51595892 GGTCACACAGAGATGGAATAGGG + Intronic
907273291 1:53303234-53303256 GGGCAGACAGGCAAGGGGCATGG + Intronic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909222639 1:72983205-72983227 GGTCACACACAGATGGGACGCGG + Intergenic
909223630 1:72991159-72991181 GGTCCCACAGAGATGGGACGTGG + Intergenic
909455053 1:75840898-75840920 GGGAACACAGAGAAGGGAGTTGG + Intronic
909944681 1:81650228-81650250 TGGAAAACAGAGAAGGAACATGG + Intronic
910898643 1:92095388-92095410 GGCCACACAGGGAAGCAACAGGG - Intronic
911930865 1:103901885-103901907 GGGTGCACAGAGGAGAGACATGG + Intergenic
912432551 1:109636681-109636703 GGGTGCTCAGGGAAGGGACAGGG + Intergenic
912775432 1:112503870-112503892 GGAGACTCAGAGAAGAGACATGG + Intronic
914292426 1:146286528-146286550 AGTAAGACAGAGAAGGGACAAGG - Intergenic
914553470 1:148737311-148737333 AGTAAGACAGAGAAGGGACAAGG - Intergenic
914792172 1:150887852-150887874 AGGAACACAGAGAAAGGAAAAGG + Intergenic
914913677 1:151805315-151805337 AGGCACACAGGGAAGGTGCAGGG - Exonic
915254542 1:154616365-154616387 GGGGACAGAGAGATGGGGCATGG - Intronic
915974489 1:160375974-160375996 GTGGAGACAGAGCAGGGACACGG - Intergenic
917744964 1:177997814-177997836 GGCCACACACAGAAGGAAGATGG - Intergenic
917942520 1:179936453-179936475 GGGAACACTGACAAGGGACCTGG - Intergenic
918389105 1:184039395-184039417 AGGCACACAGTGAAGGGGCTTGG - Intergenic
919652092 1:200160036-200160058 GCTCACGCAGAAAAGGGACATGG - Intronic
919923982 1:202182874-202182896 GGAAGAACAGAGAAGGGACAGGG - Intergenic
920182608 1:204141767-204141789 GGAGACACAGGGAAAGGACAAGG + Intronic
921055837 1:211541850-211541872 CAGCACACAGAGAAGTGAAAGGG - Intergenic
921278707 1:213544533-213544555 GGGAACACACAGAGGGGCCACGG - Intergenic
921824385 1:219655782-219655804 GGCCACAGTGAGAAGGGACCAGG - Intergenic
922042934 1:221914875-221914897 GGGCACACAGAGGAAGCAGATGG + Intergenic
922109288 1:222541967-222541989 GGGCTCACTCTGAAGGGACAAGG + Intronic
922182455 1:223246112-223246134 GGGCAGACAGAAAAGGGAACGGG + Intronic
922236863 1:223728525-223728547 AGGATCAAAGAGAAGGGACATGG + Intronic
922346472 1:224700698-224700720 GGGCCCAAACAGAAGGGACTGGG + Intronic
922603544 1:226874618-226874640 GGACACAGTGAGAAAGGACACGG - Intronic
922727082 1:227927584-227927606 GGGCACACAGAGCACGGCTAGGG + Intronic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923010917 1:230086879-230086901 GGGCACACAGGTAAGTGGCAGGG - Intronic
923142701 1:231174600-231174622 GTGGAGACAGAGAAGGGAGAGGG - Intronic
923503944 1:234589667-234589689 GGGCAAACAGATCAGGGACAAGG + Intergenic
1063034137 10:2268506-2268528 GTGCACAGAGTGAAGGGCCAGGG - Intergenic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1063138329 10:3236157-3236179 GGGCCCACAGTGAAGGGACGGGG - Intergenic
1063252777 10:4292339-4292361 GGGCACAATGGGAAGGGAAAAGG - Intergenic
1063660794 10:8034276-8034298 TGGCACACAGACAAGCGACCGGG + Intergenic
1063915110 10:10873780-10873802 GAGGATTCAGAGAAGGGACAGGG - Intergenic
1064299196 10:14107203-14107225 GGGGAGAGAGGGAAGGGACAAGG + Intronic
1065489226 10:26265888-26265910 GGGCAGTCAGAGGATGGACAAGG + Intronic
1065935538 10:30517557-30517579 GGCGAGCCAGAGAAGGGACAGGG - Intergenic
1066441506 10:35443990-35444012 GAGCACACACAAAAGAGACAGGG - Intronic
1066657796 10:37711743-37711765 CCCCACACATAGAAGGGACAAGG + Intergenic
1067360167 10:45572105-45572127 GGACACAGAGAGAAGGGGTAAGG - Intronic
1067360186 10:45572163-45572185 GGACACAGAGAGAAGGGGTAAGG - Intronic
1067498504 10:46780617-46780639 GAGCCAACAGAGTAGGGACAAGG + Intergenic
1067596142 10:47559793-47559815 GAGCCAACAGAGTAGGGACAAGG - Intergenic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068277178 10:54815331-54815353 GGGCACACAAAGACCGTACATGG + Intronic
1068322809 10:55441899-55441921 GGGCACACACAGAGAGCACAAGG + Intronic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1068941820 10:62688164-62688186 GGGGACAGGGAGAGGGGACAGGG - Intergenic
1069299714 10:66890892-66890914 GAGCACAGAGAGAAGGAGCAGGG + Intronic
1069797282 10:71061579-71061601 GGCCACACTGAGGAAGGACAGGG + Intergenic
1069914345 10:71778163-71778185 GGGGACACAGGGAAGGGACAAGG - Intronic
1070155381 10:73831183-73831205 TGGAAAACAGAGAAGGGGCATGG + Intronic
1070288673 10:75100867-75100889 GGGCACACAGAGCAGCGTCATGG - Intronic
1070338899 10:75478914-75478936 GGGTACACAGAGGATGTACATGG - Intronic
1070474949 10:76820904-76820926 GGTCCCACAGAGATGGGACACGG - Intergenic
1070575826 10:77678107-77678129 GGGGACAGAGAGAAGGGAGCAGG - Intergenic
1072060023 10:91800510-91800532 GGGAAGGCAGAGAAGGAACAAGG - Intronic
1072529039 10:96300804-96300826 GGGAACACAGGGAAGGGAAGGGG + Intergenic
1072619451 10:97069945-97069967 GGGCAAACCCAGAAGGAACAAGG - Intronic
1073291650 10:102416337-102416359 GGGCCCCCAGTGAAGGGGCAAGG - Intronic
1073561277 10:104498901-104498923 GCGCACACACAGAAGGGAGGAGG - Intergenic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1074770847 10:116732778-116732800 GGTCACTCAGAGACGGCACAAGG - Intronic
1075021201 10:118953781-118953803 GGGCTCACAGTTAAGGGACAGGG - Intergenic
1075553302 10:123410047-123410069 GGGCAGAAAGAAAAGCGACAAGG - Intergenic
1076404030 10:130200767-130200789 AGGTACACAGAGAAAGGACACGG + Intergenic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077386668 11:2272451-2272473 GGGCTCTCAGACCAGGGACAGGG - Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1077895684 11:6451488-6451510 GGGCACAGACAGAAGGGAGTAGG + Intronic
1078146574 11:8725757-8725779 GGGCACACAGCTAAGGAAGAGGG + Intronic
1078170754 11:8927292-8927314 AGGCACCTAAAGAAGGGACAGGG + Intronic
1079447483 11:20570123-20570145 GGTCCCACAGAGATGGGACATGG - Intergenic
1079464230 11:20713584-20713606 GGGCAGACAGGGAGGGGGCAAGG - Intronic
1079622049 11:22567073-22567095 GGGTTCACAGAGAAGAGAGATGG + Intergenic
1079901952 11:26197958-26197980 GGAGTCACAGAGAAGGCACAGGG - Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1080103383 11:28485517-28485539 GGGCAGAGAGAGAAGAGGCAGGG + Intergenic
1080592880 11:33738770-33738792 GGGCAAGCAGAGAAGGGGCAGGG - Intergenic
1080656577 11:34263189-34263211 GGGGACACAGAGAGGAGCCATGG + Intronic
1081343467 11:41955711-41955733 GGACCCACGGAGAATGGACAGGG + Intergenic
1081383847 11:42447698-42447720 GGTCACACAGAGGGGGCACATGG - Intergenic
1081392194 11:42542282-42542304 GGGCACAAAGGGAAGGGGGAGGG - Intergenic
1081599349 11:44482053-44482075 GTGCACACAAAGAATGAACAAGG + Intergenic
1082000445 11:47391193-47391215 GGTCACCCAGAAAAGGGAAACGG + Intergenic
1083161320 11:60855943-60855965 GGGCAGACAGAGGTGGGAGAGGG + Exonic
1083591948 11:63900754-63900776 GGGAGCACAGAGAAGGAAAAGGG - Intronic
1084111277 11:67015503-67015525 GGGAACAAAGGGAAGGGAAAGGG + Intronic
1084690255 11:70721082-70721104 GGGCACAGAGAGAAGGTGCCCGG - Intronic
1084776643 11:71381031-71381053 GAGCACACAGTGAAGGGAAGAGG - Intergenic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1084946086 11:72639339-72639361 AGCCACACAGAGAAGGGGCGAGG + Intronic
1085205976 11:74732056-74732078 GGGCAGACGGAGTGGGGACAGGG - Intergenic
1085315453 11:75542200-75542222 GGGCTCACAGAGCAGGGCCCAGG - Intergenic
1085353498 11:75815613-75815635 GGACACCCAGAGCAGGGACCCGG + Intronic
1086021657 11:82238293-82238315 GGGCAGCCAGAGAAAGGTCAGGG - Intergenic
1087978520 11:104581288-104581310 AGGCACCCAGAATAGGGACAAGG - Intergenic
1088381659 11:109200002-109200024 GACCACACAGACAAGGGATATGG - Intergenic
1089085822 11:115816005-115816027 GGGCACAATGAGAAGGGGCTTGG - Intergenic
1089458583 11:118639842-118639864 CGGCCTACAGAGAGGGGACATGG - Intronic
1089522112 11:119071848-119071870 GGACTCAGTGAGAAGGGACAGGG + Intronic
1089554136 11:119306017-119306039 TGGGACACAGTGAAGGCACATGG - Exonic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090427763 11:126620987-126621009 GGGCACAGAGAGACTGGAAAGGG + Intronic
1090555215 11:127867292-127867314 GCACAAACAGAGAAGGGAAATGG + Intergenic
1091769265 12:3140746-3140768 GGGCCCACAGGGAAGGCTCAGGG + Intronic
1091807225 12:3365434-3365456 GGGCACACAAACAGGTGACAGGG + Intergenic
1092181074 12:6447355-6447377 GAGCTCCCAGAGAAGGGTCATGG - Intronic
1093075760 12:14757067-14757089 GGGGATACAGAGAAAGGAAACGG + Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1094496037 12:30989985-30990007 GGGCACACAGAGACAACACAAGG - Intronic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095385577 12:41646054-41646076 GGGCACACAGTGGGGGGCCAGGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1095985360 12:47995671-47995693 GCTCCCCCAGAGAAGGGACAGGG + Intronic
1096272052 12:50173279-50173301 GGGTACACAGAGTAGGAACAAGG - Intergenic
1096369975 12:51060942-51060964 GGGAGCCCAGAGTAGGGACAGGG + Intergenic
1096634916 12:52952090-52952112 GGGCACAGAGAGGAGGGGCAGGG - Intronic
1096809382 12:54159939-54159961 GCACACACAAAGAAGGCACAAGG - Intergenic
1096985353 12:55752464-55752486 AGGCACAGAGTGAAGGGACTTGG + Exonic
1097277272 12:57822065-57822087 GGGAACACAGAGATGGGAACAGG + Exonic
1097396722 12:59084048-59084070 GCGTAAACAGAGAAGAGACATGG + Intergenic
1097691920 12:62741619-62741641 GGGGTCACAGAGAAGGGGCATGG - Intronic
1097715844 12:62965165-62965187 GAGCAGAAAGAGAAGGGAAAGGG + Intergenic
1098191281 12:67951697-67951719 GGACACAAATAGAAGGGAGAAGG + Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099673858 12:85731603-85731625 GGACACAGAGAGAAGGTACAAGG - Intergenic
1100515099 12:95319888-95319910 GGTCACAGAGAGAAGGGAAATGG - Intergenic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1102145062 12:110648912-110648934 GGGCACACAGAGGAGGGGCCTGG + Exonic
1102768002 12:115450257-115450279 GGGGAGACAGAGAAGAAACAAGG - Intergenic
1103172752 12:118835661-118835683 GGAAACACACAGAAGGGACACGG + Intergenic
1103226558 12:119292822-119292844 GGGCACAGTGGGAAGAGACAAGG - Intergenic
1103684600 12:122722075-122722097 GGCCACACAGAGAGGCCACAGGG - Intergenic
1104339709 12:127936847-127936869 AGGCACCCAGAGAAGGGCAAGGG + Intergenic
1106193580 13:27474979-27475001 AGGGACACAGAGAAGGAAGAGGG + Intergenic
1108596811 13:51956393-51956415 GGGCACACAAGGGAGGGGCAAGG + Intronic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1110847395 13:80205923-80205945 AGACACATAGAGAAGAGACATGG - Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1112567009 13:100560519-100560541 GGGCCAACAGGGAATGGACAGGG + Intronic
1113791579 13:113031626-113031648 CGGCCCTCAGAGAAGGGACGAGG + Intronic
1114702205 14:24690606-24690628 GGAGACATTGAGAAGGGACAAGG - Intergenic
1115272100 14:31564295-31564317 GTGCACAGAGGGAAGGGAAAAGG - Intronic
1115509445 14:34125448-34125470 GGAGATACAGAGAAGGGACCAGG + Intronic
1115929223 14:38472067-38472089 GAGCACAGAGACAATGGACAGGG - Intergenic
1116462431 14:45193077-45193099 GGGGAAACAGGGAAGGAACAAGG - Intronic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1117010790 14:51468285-51468307 GGGGAGACAGAGATGGGAGAGGG + Intergenic
1118604346 14:67491957-67491979 GGGCACAGAGGGGAAGGACAGGG - Intronic
1118697132 14:68396070-68396092 AGGATCACAGAGCAGGGACACGG + Intronic
1119432876 14:74579683-74579705 GGGGAGACAGGGAAGGGCCAGGG - Intronic
1119563435 14:75608834-75608856 GGGCACACTAATAAAGGACATGG - Intronic
1120781831 14:88492532-88492554 GGGAAGGCAGAGAAGAGACAGGG + Intronic
1121406748 14:93723706-93723728 GACCACTGAGAGAAGGGACAAGG - Intronic
1121972817 14:98374483-98374505 TGGCACACAGGGCAGAGACACGG - Intergenic
1121994770 14:98593354-98593376 AGGGACACAGAGGAGGGGCAGGG - Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1122387738 14:101360542-101360564 GGATACTCAGAGAAGGGAGAGGG + Intergenic
1122424561 14:101598325-101598347 GGGCTTAGAGAGAAGGGAGACGG + Intergenic
1122442087 14:101738930-101738952 GAGAACACAGAGAGGGGAGAGGG + Intergenic
1122460353 14:101889419-101889441 GGGCACAAAGAGAGGGAACAGGG - Intronic
1122727487 14:103767690-103767712 GGAGACACTGAGAGGGGACACGG - Intronic
1122790878 14:104183683-104183705 GGGCTCACAGGGGAGGGTCAGGG + Intergenic
1123110305 14:105864051-105864073 GGCCACACAGACGAGGGGCAAGG - Intergenic
1202870372 14_GL000225v1_random:157616-157638 AGGCCCACAGAGAAGGCAGATGG + Intergenic
1125131714 15:36290369-36290391 GGGCACAGAAATAAGGGACTGGG + Intergenic
1127642862 15:60931723-60931745 GGGCAGGAAGAGATGGGACATGG + Intronic
1128520176 15:68369965-68369987 GGAAACACAGAGGAGAGACATGG + Intronic
1128914119 15:71544104-71544126 GGGCAGATAGAGAGGAGACAGGG + Intronic
1129172378 15:73816183-73816205 AGGCACACAGAGAGAAGACAGGG + Intergenic
1129233298 15:74208729-74208751 GGGAACAGCGAGAAGGCACATGG - Intronic
1130104690 15:80920487-80920509 AGGCAAACTGAGAAGGGAGAAGG - Intronic
1130120672 15:81045020-81045042 AGGCAAAGAGAGAAGGGAGATGG - Intronic
1130202964 15:81850578-81850600 GGGCACACAGAGAAGCACCAGGG + Intergenic
1130888134 15:88110876-88110898 GGGCACACACTGAAGGGGCCAGG + Intronic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1132022220 15:98372541-98372563 GAGCACATAGAGAAAGGAAAAGG - Intergenic
1132279154 15:100597719-100597741 GGGCAGATGGAAAAGGGACAAGG - Intronic
1132648091 16:1008199-1008221 GGGCACAGAGGGCAGGGACCTGG + Intergenic
1132713210 16:1278392-1278414 GGGCACACAGAGATGGGGGAGGG - Intergenic
1132782348 16:1634519-1634541 GCCCACACGGAGAAGGGAAAAGG - Intronic
1133127159 16:3654512-3654534 GGGCCCCCAGACAAGAGACAGGG + Intronic
1133205490 16:4230814-4230836 GGACACACAGACAAGGGAGAAGG + Intronic
1133226516 16:4343334-4343356 GGGCCCACAGAGATGGGCCCTGG + Intronic
1133280020 16:4659948-4659970 GGCCACAAAGAGAAGACACACGG - Intronic
1134022401 16:10930107-10930129 AGGCACACAGAGAAGGCAGTGGG - Exonic
1134342157 16:13355945-13355967 GGTCCCACAGAGATGGGACGTGG + Intergenic
1134815004 16:17198481-17198503 GAAGACACAGAGAGGGGACAGGG - Intronic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1135516294 16:23138456-23138478 GGTCACTCAGACTAGGGACATGG - Intronic
1136377985 16:29876704-29876726 GGGCCCACAGGGAAGGGGCGGGG + Intronic
1136520291 16:30791232-30791254 GGGGACACAGAGGAATGACAGGG - Intergenic
1137279335 16:46961950-46961972 AGGCACACTGACAAGTGACATGG + Intronic
1137352341 16:47724502-47724524 GGGCACAAGGGGAAGAGACAAGG + Intergenic
1137607024 16:49793686-49793708 GTGCACACAGAGAGGAGGCATGG + Intronic
1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG + Intergenic
1137898254 16:52237520-52237542 GAGCACCCAGAGAAGGAACGGGG + Intergenic
1138264747 16:55652409-55652431 GGGCTCCCAGAGAAGCCACATGG + Intergenic
1138395558 16:56701679-56701701 GGCTACAGAGAGAAGAGACACGG + Intronic
1138433810 16:56986040-56986062 GGGCAGACAGAGAAGTCACTTGG + Intergenic
1138804971 16:60081168-60081190 GGTCACACACAGATGGGACGCGG - Intergenic
1138817400 16:60218159-60218181 GGGCACATAGAGAAGAAAAAGGG - Intergenic
1139310796 16:66026452-66026474 TGGGAGACAGAGCAGGGACAAGG + Intergenic
1141035025 16:80619148-80619170 GGGGACACAGAGACAGGAGAAGG - Intronic
1141139577 16:81488605-81488627 GGGCACACAGAGAGGGGATGGGG - Intronic
1141774000 16:86110250-86110272 GGGATCACAGAGAAGGCTCATGG + Intergenic
1142274921 16:89113383-89113405 GGCCTCACAGAAAAGGGGCAAGG - Intronic
1143095089 17:4474459-4474481 GGGCCCACCGAGAAGGGAGAAGG - Intronic
1144489912 17:15699903-15699925 GGCCAGAGTGAGAAGGGACAGGG - Exonic
1144501326 17:15787990-15788012 GCGAGGACAGAGAAGGGACAGGG + Intergenic
1144661010 17:17071035-17071057 GGGCGCCCAGAGGAGGGTCAGGG - Intronic
1144765333 17:17729437-17729459 GGGAACACAGAGGTGGCACATGG - Intronic
1144851401 17:18245889-18245911 GGGCACACACAGAGGAGCCAGGG - Intronic
1144911050 17:18682056-18682078 GGCCAGAGTGAGAAGGGACAGGG + Intronic
1145761916 17:27430136-27430158 GGACACATTTAGAAGGGACATGG - Intergenic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1146578005 17:34011820-34011842 GAGCACTCAGAGAAGGGGCGGGG - Intronic
1146765083 17:35512976-35512998 GGGCAAATAGAGGAGGGAAAGGG - Intronic
1146910018 17:36642249-36642271 GGAGACAAAGGGAAGGGACAGGG - Intergenic
1147000531 17:37359120-37359142 CGGCACACGGAGAAGGGGCGGGG + Intronic
1147381119 17:40056848-40056870 GGGGAGACAGAGAAGGCAGATGG - Intronic
1147559526 17:41500370-41500392 GAGCACAGAGAGAAGGGGCCAGG + Intergenic
1147873773 17:43606385-43606407 GGGCACAAAGTGAAGAGAGAGGG - Intergenic
1147970123 17:44214855-44214877 GAGGACACAAAGAAGAGACACGG - Intronic
1148772405 17:50075100-50075122 AGGCAGACAGAGCAGGGAAATGG + Intronic
1150222699 17:63506254-63506276 GGGCACACAAGGTAGGGACTGGG - Intronic
1151713851 17:75821572-75821594 GCACCCACAGAGGAGGGACATGG - Intronic
1151814349 17:76463992-76464014 GGGCACACAGAGAACTGCCAGGG - Intronic
1151854122 17:76709754-76709776 GGGCACACAGTGTAGGGGCTGGG + Intronic
1152318976 17:79597406-79597428 GGGCAGAAAGAGGAGGCACAGGG + Intergenic
1152406011 17:80098317-80098339 GGGCACACAGAGGAGGGCGTTGG + Intronic
1156134390 18:34019515-34019537 GGGAACACACAGCAGGGAGATGG - Exonic
1156169811 18:34469157-34469179 GGGGATAGAGAAAAGGGACATGG - Intergenic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1157382543 18:47232558-47232580 GGGGACACAGAGGAGGGATGGGG - Intronic
1157528166 18:48400906-48400928 GGCCACACAAAGATGGGGCACGG - Intronic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1160595341 18:79969593-79969615 GCGCACGCAGAGAAGGGATGAGG - Intronic
1160679934 19:407936-407958 GGGCACCGAGGGCAGGGACATGG + Exonic
1160686761 19:440516-440538 TGGAAAACAGAGCAGGGACACGG + Intronic
1160821704 19:1062058-1062080 GGCCACGCTGATAAGGGACAGGG - Intronic
1160822236 19:1063998-1064020 GGACACACAGAGGTGGGACGCGG + Intronic
1160911543 19:1476171-1476193 GGTCACTCAGAGAAGCGTCAGGG + Intronic
1161253105 19:3291766-3291788 GGGAACATGGAGAGGGGACAGGG + Intronic
1161352586 19:3802099-3802121 GGGGACAGAGGGAAGGGACAGGG - Intronic
1162200841 19:9018853-9018875 GGGGATAAAGAGAAGGAACAAGG + Intergenic
1162242354 19:9365393-9365415 AGACACAGAGAGAAGGGACCGGG + Intronic
1162286694 19:9744159-9744181 GGGCCCACAGAGAGAGGGCATGG - Intergenic
1162771043 19:12949445-12949467 GTGCCCACAGGGAAGGGAAATGG - Intronic
1163281295 19:16319658-16319680 GGGGACACAGAGATGAGTCAAGG + Intergenic
1163386963 19:17005663-17005685 GGCCATACAGGGAAGGGACAGGG + Intronic
1163526371 19:17823983-17824005 GGGCTAAGAGAGCAGGGACAGGG + Intergenic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1164400895 19:27901489-27901511 TTGTACACAGAGAAGTGACAGGG + Intergenic
1164506555 19:28865981-28866003 GGGCACACCCAGAAAGGGCATGG + Intergenic
1164630109 19:29756374-29756396 GGGAGCACAGAGAGGAGACAGGG + Intergenic
1165084742 19:33336281-33336303 GTCCACACAGAGAATGGACAAGG + Intergenic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1165806615 19:38584524-38584546 GGGCACAGGGAGAGGGGTCAGGG - Intronic
1165982669 19:39737881-39737903 GGTCACACAGAAAAGGGAAGAGG - Intronic
1166069059 19:40377125-40377147 GGGCACAGAGAGAGGGGTTAGGG + Intronic
1166197682 19:41217755-41217777 GGGCAAGCAGAGAAGGGACAGGG + Intergenic
1166317189 19:41995858-41995880 GGGGACGCAGGCAAGGGACAGGG + Intronic
1166369175 19:42291915-42291937 GGGGACACAGAGAAGGAGGAGGG - Intronic
1166406935 19:42528253-42528275 GGGCGCACAGAGAATGGCTAGGG - Intronic
1166532558 19:43551930-43551952 GTGGACACAGAGAAAGCACAAGG + Intronic
1166657453 19:44622766-44622788 GGGCATAGAGAGGAGGGAAAGGG - Intronic
1166678043 19:44751196-44751218 TGGAGGACAGAGAAGGGACATGG - Intronic
1167467594 19:49658383-49658405 GGGCTCTCAGAGAGGGGGCAGGG - Exonic
1167889609 19:52528741-52528763 GGTGACACAGAGTGGGGACAGGG + Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1167915031 19:52733937-52733959 GGAGACACAGAGTGGGGACAAGG - Intronic
1168327559 19:55545999-55546021 CGACCCACAGAGACGGGACAGGG - Intergenic
925940420 2:8811875-8811897 GGGCACACTGTGAAGGGCCCTGG + Intronic
926631548 2:15141150-15141172 GGGGAAAAAGAGAAGGGAAAAGG - Intergenic
926963493 2:18385339-18385361 GGACACACAGGGAAAGGACCAGG + Intergenic
927190849 2:20515952-20515974 GGGCACACTGGGAAGTGCCACGG + Intergenic
927514964 2:23666874-23666896 GGGCACAGAGAGAAGGGCCCTGG - Intronic
927580175 2:24236596-24236618 GGACACACAGAGAAGAGTCAAGG - Intronic
927652890 2:24922926-24922948 GGGCCCACAGAGGAGAGATAGGG - Intergenic
928053154 2:28022633-28022655 GGTCACAAAGAGTAGGCACAGGG - Intronic
928115583 2:28543292-28543314 GGGCCCACAGAGGAGGGGCAAGG + Intronic
928211804 2:29329064-29329086 GGCCACACAGAGAAGGGACATGG - Intronic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929436805 2:41934885-41934907 GAGCGCACAGAGCAGGGCCAAGG + Intergenic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930757150 2:54987559-54987581 GGTCACAGAGAGCAGGGCCAAGG + Exonic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932300798 2:70665631-70665653 GGGGACACAGAGGAGAGAGAAGG - Intronic
932849701 2:75172550-75172572 GAGAAGACAGGGAAGGGACAGGG - Intronic
933274185 2:80266303-80266325 GGGCACACAGAGAGAGCTCATGG + Intronic
933707196 2:85300573-85300595 TGGCACACTGAAAAGGAACAAGG + Intronic
933999496 2:87695728-87695750 GAGCACGCAGAGAAGGGAGTGGG + Intergenic
935132591 2:100271687-100271709 GGGGACACAGAGGTGGGCCACGG + Intergenic
936451392 2:112636390-112636412 TGGCACACAGTGGAGGGATAGGG - Intergenic
936965999 2:118128109-118128131 AGGGACAGAGAGAAGGGGCAGGG - Intergenic
937235887 2:120431798-120431820 TTGGACACAGAGACGGGACAAGG - Intergenic
937257964 2:120568204-120568226 GGGCAGACAGAGAAGCCAGAGGG - Intergenic
937345689 2:121124050-121124072 GGCCACAGGGAGAAGTGACAGGG - Intergenic
937626798 2:124053007-124053029 GGGCCCACAGAGCAGGGACGGGG - Intronic
939944412 2:148391904-148391926 GTGCACACATATAAGGGTCAAGG - Intronic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
944393947 2:199248000-199248022 GGGCACAGAAATAAGGGACTGGG - Intergenic
944584644 2:201162688-201162710 AGGCACACAGGGAGAGGACAAGG + Intronic
945145051 2:206729258-206729280 GGGCACTCAGGAACGGGACAGGG + Intergenic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
946131106 2:217607581-217607603 GGGCACATAGCACAGGGACAAGG + Intronic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
947461227 2:230306375-230306397 GGAGACACAGAGAGGGGGCATGG + Intronic
947739395 2:232478301-232478323 GGACACAGAGAGAAGGGGCCTGG + Intergenic
947740881 2:232484334-232484356 AGCCCCACAAAGAAGGGACAGGG + Intronic
947897859 2:233692206-233692228 GGGCACCCAGAGATGGCAGATGG + Intronic
947932657 2:233976442-233976464 GAGGACACAGGGCAGGGACATGG + Intronic
948058616 2:235027666-235027688 GGGCACACAGGGAATTGGCAGGG + Intronic
948071009 2:235125415-235125437 GAGCATACTCAGAAGGGACAGGG - Intergenic
948134671 2:235627844-235627866 GGCCAAACAGAGATGGGACAAGG + Intronic
948278137 2:236725762-236725784 GGGCACACACAAGAGGGAGAGGG - Intergenic
948630563 2:239299920-239299942 GGGGAGACAGAGAAGGAAGAGGG + Intronic
948815815 2:240509981-240510003 AGGCACAAAGGGCAGGGACAGGG - Intronic
948855245 2:240727300-240727322 GGGAACACAGGGAAGGGAGAGGG + Intronic
948930348 2:241127967-241127989 GGGCCCACACAGAAGGGGCCAGG + Intronic
948982062 2:241499469-241499491 GGGCCCCCTGAGAAGGGCCAGGG + Intronic
949037519 2:241822953-241822975 AGAGACACAGAGAAGAGACACGG - Intergenic
1168730494 20:74717-74739 GGACACACATGGAAGGGATAAGG - Intergenic
1169472935 20:5903978-5904000 GAGCACAGAGAGAAGGGCCAGGG + Intergenic
1169514056 20:6297081-6297103 GGTCACATAGAGAGGGCACAGGG + Intergenic
1170325467 20:15151207-15151229 GGTCCCACAGAGATGGGACGCGG + Intronic
1171465113 20:25322199-25322221 GGAGACACAGAGAAGTCACAAGG + Intronic
1172166612 20:32903407-32903429 GTGGACACACAGAAGGGAGATGG - Intronic
1173014023 20:39208875-39208897 GGGCACACAGAGTCGGCAAAAGG - Intergenic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173168491 20:40703296-40703318 GGCCCCACAGAGATGGGACTGGG + Intergenic
1173201830 20:40960351-40960373 GTGCACACAGAGTGGGGACAAGG + Intergenic
1173314191 20:41929080-41929102 AAACACACAGAGAAGGGAGAAGG - Intergenic
1173361077 20:42344869-42344891 GCGCACACAGAGAAGGTACAGGG - Intronic
1173392102 20:42644535-42644557 GGGCACAGATACAGGGGACAGGG + Intronic
1173906438 20:46633193-46633215 GAGCACACAGAGCAGGCCCAGGG + Intronic
1173907826 20:46641684-46641706 GGGCACAGTGAGAAAAGACAAGG + Intronic
1174302511 20:49592745-49592767 GTCCATACAGAGAAGGGACTGGG - Intergenic
1174452528 20:50628957-50628979 GAGCACACACAGGAGGGACCTGG + Intronic
1174983478 20:55423092-55423114 CGGCACACAGAGAATGCCCATGG + Intergenic
1175002837 20:55648325-55648347 AGGCATACAGAGGAGAGACATGG + Intergenic
1175253827 20:57626399-57626421 GGACACACATCCAAGGGACAGGG + Intergenic
1175366265 20:58458285-58458307 AGGCACAGAGAGAAGGGGCTGGG - Intergenic
1175417616 20:58812051-58812073 GGGCAGACAGAAGAGGAACAGGG - Intergenic
1175692659 20:61076646-61076668 AGACACACAGAGCAGAGACAGGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175978276 20:62724422-62724444 GGGCACTCAGACAAGGTGCAGGG + Intronic
1176285837 21:5019064-5019086 GACCACACAGAGAAGCCACATGG + Intergenic
1178003737 21:28193143-28193165 AGGCCCAGAGAGAAAGGACAGGG + Intergenic
1178924993 21:36767343-36767365 TGGCTCACACAGGAGGGACAGGG + Intronic
1179473124 21:41625521-41625543 CTGCACACAGAGTGGGGACAGGG + Intergenic
1179548956 21:42131256-42131278 GGAAAGACAGAGAAGGGAGAGGG - Intronic
1179871344 21:44244411-44244433 GACCACACAGAGAAGCCACATGG - Intergenic
1180933052 22:19606278-19606300 GGGCCGACACAGAAGGGCCAGGG + Intergenic
1181840784 22:25658565-25658587 AGGAACACAGAGAATGGAAAAGG - Intronic
1182075305 22:27491405-27491427 GGACACATAGAGAAGAAACAGGG - Intergenic
1182319954 22:29472142-29472164 GGCTCCACAGAGAAAGGACATGG + Intergenic
1182551318 22:31102336-31102358 GGGAACACAGTGATGGGGCAAGG - Intronic
1183582880 22:38736048-38736070 GGGCACAGAGGGAAGGAAGAAGG + Exonic
1183632535 22:39041994-39042016 GGTGACACAGAGACTGGACAGGG + Intronic
1183686719 22:39365243-39365265 GGGCACACAGAGCAGCCACAAGG - Intronic
1183928648 22:41223786-41223808 GGACACAGAGGGAAGGCACACGG - Intronic
1185220711 22:49627879-49627901 GCCCTCACAGGGAAGGGACAGGG + Intronic
1185233970 22:49700337-49700359 GGACACACTGAGGAGGGACAGGG - Intergenic
949827464 3:8179353-8179375 GGTCCCACAGAGATGGGACGCGG - Intergenic
949929090 3:9064336-9064358 GGGCACAAAGGGGAGGGCCATGG - Intronic
950717916 3:14862825-14862847 GGCCAGACAGAGCAAGGACAAGG - Intronic
951422413 3:22503053-22503075 GGACCTACAGAGAAGGGTCAAGG - Intergenic
951870352 3:27355239-27355261 GGGCAGATAGAGAAGGGAGGAGG - Intronic
952225633 3:31372795-31372817 AGTCCCACAGAGAAGGGTCATGG - Intergenic
952820938 3:37485078-37485100 GGGAAAACAGAGAGGGGACAGGG + Intronic
953209896 3:40866539-40866561 GGGCACACAGGGAAAAGACGAGG + Intergenic
953375486 3:42424653-42424675 GGGCAGAGGGAGAAGGGAAAGGG + Intergenic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
954980985 3:54745125-54745147 GGACACACAGGGAAGTGCCAAGG + Intronic
955192464 3:56774036-56774058 GGGAAGACAGAAAAGGGGCAGGG + Intronic
955393463 3:58537535-58537557 GGGCACACAGTGAAAGATCAGGG - Intergenic
955917738 3:63923838-63923860 GGGCACTCTGAGAAGGGAAGGGG + Intronic
956011186 3:64833314-64833336 GGGGACACAGAGAAGAGGCCAGG + Intergenic
956289732 3:67648815-67648837 GGGTGCACAGAGAAGGGAGAGGG - Intronic
956530952 3:70218047-70218069 GGGCACACAGAGTGGGCAAAAGG - Intergenic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
957734847 3:84191175-84191197 GGTCCCACACAGAAGGGACAAGG + Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
958820908 3:98972917-98972939 GGTCACACAGACAAGGGGGAAGG - Intergenic
959584474 3:108013382-108013404 AGACAGACAGAGAAGGGAGAAGG + Intergenic
960739471 3:120817154-120817176 GGGCCCACAGACAAAGGACTGGG + Intergenic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
961531238 3:127541722-127541744 GGCAGCCCAGAGAAGGGACAAGG + Intergenic
961635392 3:128329782-128329804 AGCCACACATAGGAGGGACATGG + Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
962009565 3:131380855-131380877 TGGCACATAGAGAAGTCACAGGG - Intergenic
962614064 3:137106756-137106778 GGGCACAGAGACAATGAACAAGG + Intergenic
962849812 3:139299846-139299868 GGCCAGACAGAGATGGGGCAAGG + Intronic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963189155 3:142450124-142450146 GAGCACAAAGAGGAGGGCCACGG + Intronic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963350615 3:144147065-144147087 GGGTACACAGAGAAATGAAAGGG - Intergenic
963596954 3:147340025-147340047 GGGCACACAGAGCGGGGATAAGG + Intergenic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
964014028 3:151925079-151925101 GGGAACACAGAAAAGGGAATGGG - Intergenic
964339726 3:155695897-155695919 GGGTGCAAAGAGAAGGGAAAGGG + Intronic
964698172 3:159533607-159533629 GGGCAGACAGAGCAGTGAGATGG - Intronic
965409511 3:168312642-168312664 GGGCAAACAGAAAAAGGAGATGG - Intergenic
966279324 3:178209868-178209890 GGTCCCACAGAGATGGGACAAGG - Intergenic
966919544 3:184602774-184602796 AGGAACACAGAGAGGGAACAAGG - Intronic
967417561 3:189235551-189235573 GGGGACACTGAAAGGGGACAAGG + Intronic
968489834 4:883983-884005 GGGCACACAGGGAAGGGCCGGGG + Intronic
968730054 4:2265252-2265274 GGGCTCCCAGGGAAGGGACAGGG + Intergenic
968892046 4:3374618-3374640 GGGCTCAAGCAGAAGGGACAGGG - Intronic
969616479 4:8255853-8255875 GGGGCCACAGAGAAGGGAGGCGG + Intergenic
969620814 4:8277892-8277914 GGGCACTAAAAGAAGGGGCAGGG + Intronic
969630095 4:8330846-8330868 GGGCACAGAGAGAGGGGCTAGGG + Intergenic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
971903257 4:32691605-32691627 AGCACCACAGAGAAGGGACAAGG - Intergenic
973983742 4:56329105-56329127 GTGCATACAAAGAAGGGACTTGG + Intergenic
974663049 4:64919934-64919956 TGGGTCACAGAGAAGGCACATGG + Intergenic
974965815 4:68759813-68759835 GGGCAGCCAGAGAGGGGCCATGG + Intergenic
976482557 4:85561836-85561858 GGGGAGACAGAGAAATGACAAGG + Intronic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
977225559 4:94388230-94388252 GGGCACAGAGATAAGGGATCAGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979147790 4:117267202-117267224 GTCCAGAAAGAGAAGGGACAAGG + Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
981754497 4:148126932-148126954 TGGCACACAGAGAAAGGAGAAGG - Intronic
982065691 4:151652684-151652706 GGCCTCACAGAGGAGGGGCATGG + Intronic
982091653 4:151884780-151884802 GGCCAGGCAGACAAGGGACAAGG + Intergenic
982145060 4:152378388-152378410 TGGAGCACAGATAAGGGACAAGG - Intronic
982318827 4:154058613-154058635 GGTCCCACAAAGATGGGACATGG - Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
984810462 4:183791872-183791894 GGGCAAAGAGAGAAGAGACTGGG + Intergenic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985774104 5:1831747-1831769 GGGCACAGAGAGGATGGAGAGGG - Intergenic
985874891 5:2587075-2587097 TGGCACACATAGGAGGCACAGGG - Intergenic
985898147 5:2762893-2762915 GGGAACTCTGAGAAGCGACAGGG - Intergenic
986022049 5:3813308-3813330 GGTCACACACAGAATGGTCAGGG + Intergenic
986338388 5:6770960-6770982 GGACACACAGAGAAAGGGCAAGG + Intergenic
986808962 5:11335764-11335786 TGGCACACAGAAAAGGGAGTGGG - Intronic
986897337 5:12385726-12385748 GGGGACACAGAGAACAGAGAGGG - Intergenic
988461657 5:31444115-31444137 CAGCACACGGGGAAGGGACAGGG + Intronic
989685043 5:44075397-44075419 GGGCACACAGAAGAGTGACCAGG + Intergenic
989987196 5:50714711-50714733 AGTCACACAGAGAAGGAACCAGG + Intronic
989992463 5:50783192-50783214 GGGGAGACAGGGAAGGGAGATGG + Intronic
990705768 5:58527729-58527751 GGTCACAGAGAGAAGAGATAGGG + Intergenic
991982129 5:72243103-72243125 GGGTAGACAGAGATGGGAGAGGG + Intronic
992155376 5:73950373-73950395 TGCTACACAGAGAAGGGACTGGG - Intergenic
992845545 5:80743326-80743348 GAGAGCACAGAGAAGGTACAAGG - Intronic
992989980 5:82274296-82274318 GGCCACACAGAGAAAGGAGAAGG + Exonic
993486597 5:88494987-88495009 AAGAACACAGAGAAAGGACATGG + Intergenic
994296320 5:98092791-98092813 GGGAGCACAGAGATGGGAGAGGG + Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
995328380 5:110918228-110918250 GGGTACAGAGAGAAGGGACAAGG + Intergenic
995841177 5:116444786-116444808 GTGCACACAAAGAAATGACATGG - Exonic
996764834 5:127025525-127025547 GGGCAAAAAGTGAAGGGTCAGGG - Intronic
997291418 5:132738399-132738421 CAGCACACTGAAAAGGGACAAGG - Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
997769661 5:136542990-136543012 GGTCCCACAGAGATGGGACGTGG + Intergenic
998271571 5:140711102-140711124 GGGGACACACAGCAGTGACAAGG - Intergenic
998382022 5:141732386-141732408 GGACAAACAGAGAAGAGAGAGGG - Intergenic
998613633 5:143716372-143716394 GGGCAAACACAGAAGCTACAAGG - Intergenic
999108328 5:149093481-149093503 GAGCACACAGTGCAGGGACCTGG + Intergenic
999903927 5:156118464-156118486 ATGCACACAGAGAAGAGTCAGGG + Intronic
1000026697 5:157364626-157364648 GGGAACACAGAGCAGGGATTAGG + Intronic
1000178937 5:158788337-158788359 GGGCACAGAAAGGAGGGAAAAGG + Intronic
1000409339 5:160921779-160921801 GGGCACACAGCAGAGGGCCAAGG - Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001254448 5:170172627-170172649 CTTCACACAGAGTAGGGACAAGG + Intergenic
1001543071 5:172552615-172552637 GGGCACACACAGTCTGGACAGGG + Intergenic
1001597601 5:172908096-172908118 GGCCACACACATCAGGGACAGGG - Intronic
1002039892 5:176505257-176505279 GAGGCCACAGAGCAGGGACAGGG + Intronic
1002247611 5:177897271-177897293 AGGCACAGAGAGAAATGACAAGG - Intergenic
1002819198 6:708207-708229 GAGCACACCAAGGAGGGACAAGG - Intergenic
1003060541 6:2859045-2859067 GCCCAGACAGAGAAGGGGCAGGG - Intergenic
1003119967 6:3311211-3311233 GGGGACACAGAGCAGGGACTGGG + Intronic
1003157842 6:3611427-3611449 GAGAACACAGAGAAGGGAAGAGG - Intergenic
1003273825 6:4630963-4630985 GGGCACACAGGGAACGGAGATGG + Intergenic
1005821422 6:29602696-29602718 GGGTACACAGGGAAAGTACATGG + Exonic
1006303689 6:33207173-33207195 GGGGACTCAGAGAAAGGAGAGGG - Intergenic
1006601701 6:35230870-35230892 AGGCAAACTGAGAAGGGCCATGG + Intronic
1006786254 6:36669332-36669354 GGGGACACAGACCAGGGTCAGGG - Intergenic
1006914310 6:37584824-37584846 AGGAGCACAGAGAAGGGAGAAGG - Intergenic
1006935587 6:37715446-37715468 GGGAAGAAAGAGAAGGGACAGGG - Intergenic
1007168768 6:39847605-39847627 GGACACACAGAGCAAGGACCTGG - Intronic
1007246816 6:40469125-40469147 AGACACACAGAGAGGGGAAAAGG + Intronic
1007481437 6:42152955-42152977 GGGAAGAAAGAGAAGAGACATGG - Intergenic
1007921636 6:45615623-45615645 GGGGACAGGGAAAAGGGACAGGG - Intronic
1009379162 6:63007646-63007668 GGTCCCACAGAGATGGGACATGG - Intergenic
1009750286 6:67872343-67872365 GGTCCCACATAGATGGGACATGG + Intergenic
1013561436 6:111309361-111309383 GGGCAGTCAGAGAAGAGACGGGG - Intronic
1014454851 6:121623817-121623839 GGTCCCACAGAGATGGGACGTGG + Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1016544864 6:145209723-145209745 GAGGACACAGAGAATGGGCAGGG + Intergenic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1018909998 6:168096407-168096429 GGGCAGACAGACAAGGGCCCAGG + Intergenic
1018984102 6:168622817-168622839 TGGCATCCATAGAAGGGACAAGG + Intronic
1019181138 6:170187848-170187870 GGGGACACAGCTCAGGGACAAGG - Intergenic
1019428533 7:988239-988261 GGGCACAGAGAGAGGGGCCCCGG - Intronic
1019475616 7:1242737-1242759 GGGCACACAGAGAAGCCGCGGGG + Intergenic
1019964148 7:4485019-4485041 GGGCAGAGAGAGAAGAGAGAGGG + Intergenic
1021926943 7:25543119-25543141 GGAGACACAGAGGAGGGGCAAGG - Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1024142423 7:46475710-46475732 GGCCACACAGAGCAAGGTCAAGG + Intergenic
1024226671 7:47330750-47330772 GGGCGCCCAGAGAAGACACACGG + Intronic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1025087103 7:56032307-56032329 GGGTACAAAGACAAGGGAGAGGG + Intronic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1028463595 7:91123701-91123723 GGAGAGGCAGAGAAGGGACAAGG - Intronic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1028951066 7:96635476-96635498 GGACACACAGAAAAGGAGCAAGG + Intronic
1029531459 7:101128108-101128130 GGACACAGAGGGAAGGGAGATGG + Intronic
1029635040 7:101777942-101777964 GGGCACACAGCGATGGGAGCAGG + Intergenic
1031525372 7:122817886-122817908 GGGCACAGAGATAAGGGATTGGG - Intronic
1031727911 7:125262280-125262302 GGTCCCACACAGAAGGGACATGG + Intergenic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1034051467 7:147988649-147988671 AGGCACCCAGAGAGAGGACATGG - Intronic
1034531280 7:151697664-151697686 GGGGGCACAGAGAATGGGCACGG + Intronic
1034712371 7:153204939-153204961 GAGTACAGAGAGAAGGGAAAGGG - Intergenic
1034828161 7:154286179-154286201 GGGTACCCTGAGAAGGGACATGG + Intronic
1035082434 7:156228173-156228195 AGGTACACAGAGAAGAGAAATGG + Intergenic
1035388440 7:158489790-158489812 GGGGAAACAGAGAAGAGACGCGG + Intronic
1035436883 7:158866169-158866191 GGGGACACTGGGAAGGCACAAGG - Intronic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1036549502 8:9804127-9804149 GGAGACACAGAGAAGGGGGATGG - Intergenic
1036630908 8:10514363-10514385 AGGCAGACAGTGAAAGGACAGGG + Intergenic
1036778971 8:11632793-11632815 GGGCACACAGGCACGGGACTTGG + Intergenic
1037703480 8:21295945-21295967 GGAGACAGAGAGAAGGGAGAGGG - Intergenic
1039213040 8:35236843-35236865 TGGAACACAGAGAAGGAAAAAGG - Intronic
1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG + Intergenic
1040303767 8:46201615-46201637 AGGCAAGCAGAGAGGGGACACGG + Intergenic
1040781464 8:51114781-51114803 GGGAGCAGAGAGAAGGGAGAAGG - Intergenic
1042386626 8:68183214-68183236 GGGTATACAGAGAAAGGACATGG + Intronic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043879189 8:85522513-85522535 GGGGACACATAGAATGCACAAGG - Intergenic
1044250740 8:90001666-90001688 GGGCGCAAAGAGAGAGGACAGGG + Intronic
1044250778 8:90001790-90001812 GGGCTCAAAGAGAGAGGACAGGG + Intronic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1047363418 8:124190578-124190600 GGGGACACAGAGCAAAGACAAGG - Intergenic
1047505901 8:125479975-125479997 GGGAACACAGAGAAGGAAGCAGG - Intergenic
1047679893 8:127243907-127243929 GGGCAGAAAGAAAAGGGACAAGG + Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1048075142 8:131061831-131061853 GGGAAGACAGAGAAGGAAGAAGG - Intergenic
1049575484 8:143387891-143387913 GCGCACACAGAGAGGGGCCAGGG - Intergenic
1049646858 8:143739457-143739479 GGACACACAGAGACCGGAAAGGG + Intergenic
1050258086 9:3814529-3814551 GGTCCCACAAAGATGGGACATGG + Intergenic
1050507433 9:6362560-6362582 GGGCACACAGACTTGGGATAAGG - Intergenic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1050715180 9:8516296-8516318 TGGCACACAGAGAAGATATATGG + Intronic
1050857782 9:10383070-10383092 AGTCATACAAAGAAGGGACATGG + Intronic
1050914836 9:11118563-11118585 GGGGATACAGTGAAGGGACTAGG + Intergenic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1053002705 9:34586059-34586081 GAGCCCACACAGTAGGGACATGG - Intronic
1053004691 9:34596718-34596740 GGGCAAGCAGAGAGAGGACAGGG + Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1053079463 9:35162282-35162304 GCGCACGCAGAGCAGTGACATGG - Exonic
1053289321 9:36869603-36869625 GGGAACACAGAGAAGGGGGATGG - Intronic
1053430578 9:38039543-38039565 GGGCCCACAGGGAGGGGCCAAGG - Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056275580 9:84991546-84991568 GGGCTCAAAGGGAAGGGAGAGGG - Intronic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1057982101 9:99672492-99672514 GGTCCCACATAGATGGGACATGG - Intergenic
1058232194 9:102440569-102440591 AGGAACACAGAGAAGAGAAATGG + Intergenic
1058525916 9:105857524-105857546 GGGAACAGAGAGAAGGGTCTGGG - Intergenic
1058945087 9:109848441-109848463 GGGCACAAAGATAAGTCACAGGG - Intronic
1059497502 9:114721571-114721593 CAGCACACAGAGCAGGGAGAAGG - Intergenic
1060066237 9:120503764-120503786 GGGGACAGAGAGAGGTGACACGG - Intronic
1060464238 9:123888216-123888238 GGGGATACATTGAAGGGACACGG + Intronic
1060521157 9:124294882-124294904 GGACCCAATGAGAAGGGACAAGG + Intronic
1061016959 9:127986868-127986890 GAGCACACAGAGCAGGGAGTGGG - Intergenic
1061218402 9:129235176-129235198 GGGTACACAGCCAAGTGACAGGG - Intergenic
1061267979 9:129519320-129519342 GGTCACACAGTGAAGGGTCACGG - Intergenic
1061620618 9:131809187-131809209 AGGCACAAAGAAAAGGGAAAAGG + Intergenic
1061882285 9:133574374-133574396 GGGCACCTGGAGGAGGGACAGGG + Intronic
1061884023 9:133582616-133582638 GGGCACAAAGAAGAGGGCCATGG - Intronic
1062190461 9:135245382-135245404 GGGCAGACTGAGCTGGGACAAGG - Intergenic
1062261617 9:135665823-135665845 GGGCTCTCAGCGCAGGGACAGGG - Intronic
1062261851 9:135666809-135666831 GGGCAGAGAGGGGAGGGACAGGG - Intergenic
1062417906 9:136462588-136462610 TGGCACACACAGCAGGGGCACGG + Intronic
1062621839 9:137426346-137426368 GGGCCGTCAGAGAAGGAACAAGG - Intronic
1203451051 Un_GL000219v1:117140-117162 AGGGACATAGAGAAGGGATAGGG - Intergenic
1186309729 X:8304427-8304449 AGGAACACAGAGAAAGGAAAAGG - Intergenic
1186830483 X:13385040-13385062 GAGCACACACAGCAGGAACAAGG + Intergenic
1187283744 X:17883099-17883121 GGAGACAGAGAGAAGGGAGAAGG + Intergenic
1188353743 X:29163627-29163649 GTAGACACAGAAAAGGGACATGG + Intronic
1189075953 X:37914579-37914601 GGGGAGACAGAGATGGGATAAGG + Intronic
1189100209 X:38181243-38181265 GGGCAAAGAGAGAATGCACATGG + Intronic
1189166506 X:38866323-38866345 GAGGACAGAGAGAAGGGAAAAGG + Intergenic
1189279201 X:39809340-39809362 GGGCGCACAGAGATGGGGGAGGG - Intergenic
1189535178 X:41927890-41927912 AGGCACACAGAAATGGGAAAGGG - Intergenic
1190322950 X:49189011-49189033 GGGTAAACAGAGAGGGGCCAAGG + Exonic
1191690716 X:63935191-63935213 CGGCAGACAGAGAAAGGACTGGG + Intergenic
1191741352 X:64438607-64438629 GTGCAGACAGAGAAGCCACATGG + Intergenic
1192571444 X:72209527-72209549 GGGCATAAAAAGAAAGGACAAGG - Intronic
1193537114 X:82729194-82729216 AGTCCCACACAGAAGGGACATGG - Intergenic
1193569859 X:83128520-83128542 GGGCTCACAGAGAGGAGAAACGG - Intergenic
1193656570 X:84205605-84205627 GGGCATTTAGAGAAGGGCCAGGG - Intergenic
1193723787 X:85017454-85017476 GAGCACACAGAGAGGGAAGAGGG - Intronic
1194674147 X:96773403-96773425 GGACACACAGAGAGGTGCCAGGG + Intronic
1194739267 X:97552920-97552942 GGGCACAGTGAGAAGGGCCAAGG - Intronic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1196124277 X:112082670-112082692 GGGCGCAGAAAGAAGGGAAAAGG - Exonic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1199740868 X:150735030-150735052 AGGCACACACAGAAGGAAGATGG + Intronic
1199788547 X:151128050-151128072 GGGCACCCACAGAACGCACAGGG - Intergenic
1200354848 X:155537724-155537746 TGGCACAGAGAGAGGGGACAAGG - Intronic
1201858613 Y:18571697-18571719 GGGCACAAAGAGGGGGGAAAGGG - Intronic
1201874708 Y:18748684-18748706 GGGCACAAAGAGGGGGGAAAGGG + Intronic
1202626927 Y:56869452-56869474 AGGCCCACAGAGAAGGCAGATGG + Intergenic