ID: 1146448711

View in Genome Browser
Species Human (GRCh38)
Location 17:32954564-32954586
Sequence GAGATGTATCTCTTCTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146448711_1146448719 1 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448719 17:32954588-32954610 CTTTGGGAGAGGTTGGCATTGGG No data
1146448711_1146448721 5 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448721 17:32954592-32954614 GGGAGAGGTTGGCATTGGGGAGG No data
1146448711_1146448718 0 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448718 17:32954587-32954609 TCTTTGGGAGAGGTTGGCATTGG No data
1146448711_1146448717 -6 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448717 17:32954581-32954603 CATCTCTCTTTGGGAGAGGTTGG No data
1146448711_1146448720 2 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448720 17:32954589-32954611 TTTGGGAGAGGTTGGCATTGGGG No data
1146448711_1146448716 -10 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448716 17:32954577-32954599 GATACATCTCTCTTTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146448711 Original CRISPR GAGATGTATCTCTTCTGTAG GGG (reversed) Intergenic
No off target data available for this crispr