ID: 1146448716

View in Genome Browser
Species Human (GRCh38)
Location 17:32954577-32954599
Sequence GATACATCTCTCTTTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146448708_1146448716 21 Left 1146448708 17:32954533-32954555 CCAGTTTGCTGAAAGACAGACCT No data
Right 1146448716 17:32954577-32954599 GATACATCTCTCTTTGGGAGAGG No data
1146448707_1146448716 22 Left 1146448707 17:32954532-32954554 CCCAGTTTGCTGAAAGACAGACC No data
Right 1146448716 17:32954577-32954599 GATACATCTCTCTTTGGGAGAGG No data
1146448711_1146448716 -10 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448716 17:32954577-32954599 GATACATCTCTCTTTGGGAGAGG No data
1146448710_1146448716 1 Left 1146448710 17:32954553-32954575 CCTGCACGTGGCCCCTACAGAAG No data
Right 1146448716 17:32954577-32954599 GATACATCTCTCTTTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146448716 Original CRISPR GATACATCTCTCTTTGGGAG AGG Intergenic