ID: 1146448720

View in Genome Browser
Species Human (GRCh38)
Location 17:32954589-32954611
Sequence TTTGGGAGAGGTTGGCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146448712_1146448720 1 Left 1146448712 17:32954565-32954587 CCCTACAGAAGAGATACATCTCT No data
Right 1146448720 17:32954589-32954611 TTTGGGAGAGGTTGGCATTGGGG No data
1146448711_1146448720 2 Left 1146448711 17:32954564-32954586 CCCCTACAGAAGAGATACATCTC No data
Right 1146448720 17:32954589-32954611 TTTGGGAGAGGTTGGCATTGGGG No data
1146448710_1146448720 13 Left 1146448710 17:32954553-32954575 CCTGCACGTGGCCCCTACAGAAG No data
Right 1146448720 17:32954589-32954611 TTTGGGAGAGGTTGGCATTGGGG No data
1146448713_1146448720 0 Left 1146448713 17:32954566-32954588 CCTACAGAAGAGATACATCTCTC No data
Right 1146448720 17:32954589-32954611 TTTGGGAGAGGTTGGCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146448720 Original CRISPR TTTGGGAGAGGTTGGCATTG GGG Intergenic